Beta-mannase, coding gene as well as producing strain and application thereof

A mannanase and gene technology, which is applied in the field of genetic engineering to achieve the effects of good heat resistance and wide range

Active Publication Date: 2013-08-21
CENT SOUTH UNIV
View PDF6 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report of thermostable β-mannanase at 75℃ and above in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-mannase, coding gene as well as producing strain and application thereof
  • Beta-mannase, coding gene as well as producing strain and application thereof
  • Beta-mannase, coding gene as well as producing strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1. Screening of Aspergillus sp.T16 producing high temperature β-mannanase

[0051] The soil samples collected from the orange orchard in Yuelu Mountain, Changsha City, Hunan Province were enriched and cultured (enriched medium: 0.5% konjac flour was dissolved in basal salt medium, pH was adjusted to 5.0, 30°C, 200rpm) for 48 hours. Dilute the enriched medium by 10 4 -10 6 After doubling, each 0.2mL was coated with a primary screening plate (1.5% agar powder and 0.2% Congo red were added to the enrichment medium), and cultured at a constant temperature of 30°C for 2-3 days. After the primary screening plate grows, when a transparent hydrolysis circle appears around the colony, it is picked and inoculated in a 24-well cell culture plate containing enriched medium, and cultured at 30°C and 200rpm for 48h. Take the supernatant of the culture medium and dilute it to an appropriate multiple, use 0.5% locust bean gum as the substrate, measure the enzyme activity in t...

Embodiment 2

[0054] Example 2. Obtaining the whole gene of high-temperature β-mannanase from the fungus Aspergillus sp.T16

[0055] 1. High temperature β-mannanase N-terminal and C-terminal amino acid sequence sequencing

[0056] Aspergillus sp.T16 was cultured in induction medium (0.5% konjac flour and 1.0% peptone dissolved in basal salt medium, pH 5.0, 35°C, 200rpm) for 48 hours, the mycelium was removed by gauze filtration, and the culture supernatant was dialyzed After bag concentration, dialysis and SephadexTM G-75 gel purification, N and C-terminal amino acid sequencing was carried out. The N-terminal sequence was SFASTSGLQF, and the C-terminal sequencing result was TDHVAAIGSA. The two were derived from Aspergillus usamii (ADZ99027.1), Aspergillus kawachii (GAA89125.1), Aspergillus niger (ACJ06979.1, ADK88903.1, AEY76082.1) and Aspergillus sulphureus (ABC59553.1) have high homology; For gene sequence alignment, the upstream degenerate primer ManTF-5TCCTTCGCCAGCACCTCSGG3 and the dow...

Embodiment 3

[0061] Embodiment 3, the preparation of recombinant high-temperature β-mannanase

[0062] Synthesize primers ManPF-5CCGCTCGAGAAAAGAGAGGCTGAAGCTTCCTTCGCCAGCACCTCCGG3 (C^TCGAG is the Xho I restriction site) and ManPR-5GCTCTAGATCAAGCACTACCAATAGCAGCAACATG3 (T^CTAGA is the Xba I restriction site) according to the cDNA sequence encoding the mature high-temperature β-mannanase, for example The cDNA sequence encoding the mature high-temperature β-mannanase obtained in 2 was used as a template for PCR amplification. The PCR amplification parameters were: denaturation at 95°C for 5 minutes; denaturation at 94°C for 1 minute, deactivation at 52°C for 1 minute, and extension at 72°C for 2 minutes. 30 cycles; fully extended at 72°C for 15min.

[0063] The pGAPZαA and pPICZαA plasmids were double-digested with Xho I and Xba I, and the above PCR products were double-digested at the same time, and the double-digested PCR products were ligated with the double-digested pGAPZαA and pPICZαA plasm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses beta-mannase, a coding gene as well as a producing strain and application thereof. The fungus of the high-temperature beta-mannase is Aspergillus sp.T16 with a preservation number of CCTCC NO: M2013122. The novel high-temperature mannase gene manT16 obtained by cloning the fungus has a nucleotide sequence as shown in SEQ ID NO.2 or 3. The beta-mannase obtained by coding has an amino acid sequence as shown in SEQ ID NO.1, as well as a recombinant vector for coding the mannase gene and yeast genetically engineered bacterium. The mannase has an optimum temperature of 75 DEG C and an optimum pH value of 3.5-5.0, and is tolerable to the high temperature of 75 DEG C and stable under the pH value of 2.2-8.0. Moreover, as novel high temperature enzyme, the beta-mannase has a great production application value and extensive application prospect in industries of feed, food, medicines, wine brewing, energy and the like.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and the invention relates to a strain of Aspergillus sp.T16 producing high-temperature β-mannanase, a high-temperature β-mannanase obtained from the bacterium and a coding gene, and a The recombination carrier of the high temperature enzyme gene, yeast genetic engineering bacteria, and their application. technical background [0002] β-mannanase (endo-1,4-β-D-mannanmanno hydroase EC3.2.1.78) is a class of endohydrolase that hydrolyzes the glycosidic bond of β-1,4-D-mannan, belonging to semi cellulase. It can hydrolyze plant polysaccharides such as mannan, glucomannan, galactomannan and galactoglucomannan. Mannan is abundant in nature and widely exists in plant cells, such as konjac powder, Tianqing gum, carob gum, Australian palmetto, etc. (Dhawan S. & Kaur J., Critical reviews in biotechnology, 27 (4): 197-216). Mannanase hydrolyzes mannan into oligosaccharides, which are connected by two ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19C12N1/14C12R1/84C12R1/66
Inventor周洪波郑甲王冶
OwnerCENT SOUTH UNIV