Recombinant porcine interleukin 4-Fc fusion protein as well as coding gene and expression method thereof

A technology of interleukin and fusion protein, which is applied in the field of recombinant porcine interleukin 4-Fc fusion protein and its coding gene, its expression, purification and inclusion body refolding, which can solve the problems of inactivity, precipitation and poor product quality. Qualified and other issues, to achieve the effects of long-acting repeated medication, improved expression efficiency, and avoid repeated medication

Active Publication Date: 2013-08-28
GENSUN INST OF BIOMEDICINE
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, most recombinant proteins expressed by E. coli are insoluble, inactive intracellular aggregates known as inclusion bodies
The renaturation of inclusion bodies is a very complicated process. If the renaturation conditions are not suitable, there will be mismatching of disulfide bonds in the molecule, and covalent or hydrophobic bonds between molecules will form aggregates. On the one hand, the specific activity of the recombinant protein will be reduced. rate, resulting in unqualified product quality, and at the same time, precipitation occurs, which affects the yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant porcine interleukin 4-Fc fusion protein as well as coding gene and expression method thereof
  • Recombinant porcine interleukin 4-Fc fusion protein as well as coding gene and expression method thereof
  • Recombinant porcine interleukin 4-Fc fusion protein as well as coding gene and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1 Recombinant porcine interleukin 4-Fc fusion protein gene optimization design

[0071]According to the cDNA sequence of porcine interleukin 4 (Sus scrofa interleukin4) published by GenBank (GenBank accession number: NM_214123.1) and the cDNA sequence of porcine IgG Fc fragment (Sus scrofa IgG heavy chain) (GenBank accession number: NM_213828 .1) In the hinge region, CH2 region and CH3 region, these two genes are directly fused and codon optimized to obtain the gene of the recombinant porcine interleukin 4-Fc fusion protein of the present invention, as shown in SEQ ID No: 1 .

[0072] The following is the codon optimization of the recombinant porcine interleukin 4-Fc fusion protein. The parameters before and after optimization are compared as follows:

[0073] 1. Codon Adaptation Index (CAI)

[0074] Depend on Figure 2-a It can be seen that before codon optimization, the codon adaptation index (CAI) of the recombinant porcine interleukin 4-Fc fusion protei...

Embodiment 2

[0085] Embodiment 2: The expression plasmid construction of recombinant porcine interleukin 4-Fc fusion protein gene

[0086] The fragment synthesized from the optimized recombinant porcine interleukin 4-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing KingScript Technology Co., Ltd.) to obtain a Long-term preservation of the plasmid, recorded as pUC57-prIL4-Fc plasmid. Using the pUC57-prIL4-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:

[0087] Upstream primers:

[0088] P1: GGGAATTCCATATGCATAAGTGTGATATTACGC

[0089] Downstream primers:

[0090] P2: CCGCTCGAGTCATTTGCCCTGGGTTTTGC

[0091] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymerase...

Embodiment 3

[0093] Example 3 High Expression and Identification of Recombinant Porcine Interleukin 4-Fc Fusion Protein in Escherichia coli

[0094] Specific steps are as follows:

[0095] 1. Transform the pET21b-pIL4-Fc plasmid with correct sequencing alignment in Example 2 into Escherichia coli BL21 (DE3) competent strain (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), at 37°C, on a plate containing ampicillin Incubate overnight.

[0096] 2. Pick 1-4 recombinant colonies containing the pET21b-prIL4-Fc plasmid the next day, insert them into LB medium containing 100 μg / mL ampicillin (purchased from Amresco), and culture overnight at 37°C.

[0097] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg / mL ampicillin, and culture with shaking at 37°C.

[0098] 4. Measure the OD of the bacterial solution every 1 h after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 mmol / L IPTG (purchas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides recombinant porcine interleukin (IL) 4-Fc fusion protein, a coding gene and an expression, purification and inclusion body renaturation method thereof, which belong to the field of the biological genetic engineering. Porcine IL4 can be used for treating porcine chronic infectious diseases and parasitic diseases and can be further popularized and applied to preventing and treating diseases such as porcine anaphylactic reaction and the like which are related to immunity. However, the porcine IL4 has the defects of high clearing speed in plasma and high industrialization cost. The invention provides long-acting recombinant porcine IL4-Fc fusion protein by adopting an escherichia coli prokaryotic expression system, wherein the porcine IL4 part includes the whole sequence of a porcine IL4 extracellular region, the Fc segment part includes a hinge region of antibodies, a CH2 region and a CH3 region, and the porcine IL4 part and the Fc segment part are directly fused. According to the recombinant porcine IL4-Fc fusion protein provided by the invention, the biological activity of the IL4 is improved, the half-life period of the IL4 is greatly prolonged, and the guarantee is provided for the low-cost mass expression and the industrialization of the expression.

Description

technical field [0001] The invention belongs to the field of bioengineering genes, and relates to a recombinant porcine interleukin 4-Fc fusion protein and its encoding gene, as well as its expression, purification and inclusion body renaturation methods. Background technique [0002] Interleukin 4 (IL-4) is synthesized and secreted by activated T cells, mast cells and basophils. It is a multifunctional lymphokine with a variety of complex biological activities, including the regulation of T lymphocytes. growth, reproduction and differentiation; regulate the differentiation process of T cells stimulated by antigens; regulate the ability of differentiated T cells to produce cytokines such as IL-4, IL-5, IL-10 and IL-13; control the switching of immunoglobulin types specificity, etc. In addition, the induced response of IL-4 to T cells, B cells, and NK cells also plays an important regulatory role in clearing helminth infection, treating tumors, and autoimmune diseases. It c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C07K1/14C12N15/29C12N15/70C12N1/21C12P21/02C12R1/19
Inventor马永王安良章成昌陈晨徐春林王耀方
OwnerGENSUN INST OF BIOMEDICINE