Recombinant porcine interleukin 4-Fc fusion protein as well as coding gene and expression method thereof
A technology of interleukin and fusion protein, which is applied in the field of recombinant porcine interleukin 4-Fc fusion protein and its coding gene, its expression, purification and inclusion body refolding, which can solve the problems of inactivity, precipitation and poor product quality. Qualified and other issues, to achieve the effects of long-acting repeated medication, improved expression efficiency, and avoid repeated medication
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0070] Example 1 Recombinant porcine interleukin 4-Fc fusion protein gene optimization design
[0071]According to the cDNA sequence of porcine interleukin 4 (Sus scrofa interleukin4) published by GenBank (GenBank accession number: NM_214123.1) and the cDNA sequence of porcine IgG Fc fragment (Sus scrofa IgG heavy chain) (GenBank accession number: NM_213828 .1) In the hinge region, CH2 region and CH3 region, these two genes are directly fused and codon optimized to obtain the gene of the recombinant porcine interleukin 4-Fc fusion protein of the present invention, as shown in SEQ ID No: 1 .
[0072] The following is the codon optimization of the recombinant porcine interleukin 4-Fc fusion protein. The parameters before and after optimization are compared as follows:
[0073] 1. Codon Adaptation Index (CAI)
[0074] Depend on Figure 2-a It can be seen that before codon optimization, the codon adaptation index (CAI) of the recombinant porcine interleukin 4-Fc fusion protei...
Embodiment 2
[0085] Embodiment 2: The expression plasmid construction of recombinant porcine interleukin 4-Fc fusion protein gene
[0086] The fragment synthesized from the optimized recombinant porcine interleukin 4-Fc fusion protein gene (as shown in SEQ ID No: 1) was constructed into the pUC57 plasmid (provided by Nanjing KingScript Technology Co., Ltd.) to obtain a Long-term preservation of the plasmid, recorded as pUC57-prIL4-Fc plasmid. Using the pUC57-prIL4-Fc plasmid as a template, NdeI and XhoI restriction sites were introduced upstream and downstream, respectively, for PCR amplification. The primer sequences used are as follows:
[0087] Upstream primers:
[0088] P1: GGGAATTCCATATGCATAAGTGTGATATTACGC
[0089] Downstream primers:
[0090] P2: CCGCTCGAGTCATTTGCCCTGGGTTTTGC
[0091] The total volume of the reaction was 50 μL, in which 2.5 μL of each primer was added at a concentration of 10 μmol / L, and 1 μL of dNTP at a concentration of 10 mmol / L was added. The DNA polymerase...
Embodiment 3
[0093] Example 3 High Expression and Identification of Recombinant Porcine Interleukin 4-Fc Fusion Protein in Escherichia coli
[0094] Specific steps are as follows:
[0095] 1. Transform the pET21b-pIL4-Fc plasmid with correct sequencing alignment in Example 2 into Escherichia coli BL21 (DE3) competent strain (purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), at 37°C, on a plate containing ampicillin Incubate overnight.
[0096] 2. Pick 1-4 recombinant colonies containing the pET21b-prIL4-Fc plasmid the next day, insert them into LB medium containing 100 μg / mL ampicillin (purchased from Amresco), and culture overnight at 37°C.
[0097] 3. Take 50 μL of the overnight culture in step 2, add 5 mL of LB culture solution containing 100 μg / mL ampicillin, and culture with shaking at 37°C.
[0098] 4. Measure the OD of the bacterial solution every 1 h after inoculation 600 value, to be OD 600 When =1.0, the expression was induced with 1 mmol / L IPTG (purchas...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap