Bluetongue virus serum 1 (BTV1) VP2 protein monoclonal antibody (BTV1-4B6), B-cell epitope polypeptide identified by BTV1-4B6 and application of BTV1-4B6
A bluetongue virus, monoclonal antibody technology, applied in antiviral immunoglobulins, antiviral agents, antibodies, etc., can solve problems such as lack of reagents
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1B
[0044] Prokaryotic expression and purification of embodiment 1BTV1-VP2 protein
[0045] 1. Primer Design
[0046] According to the BTV1VP2 gene sequence registered in Genbank (accession number: JN848760.1), design PCR amplification primers, the sequence is as follows:
[0047] BTV1-VP2-BamHI-1-23F: 5'CTGGATCCATGGATGAACTAGGCATCCCAGT3'
[0048] BTV1-VP2-Hind-2886-2865R: 5'GCCAAGCTTTCATACGTTGAGAAGTTTTGTC3'
[0049] The underlined part is the introduced restriction site of BamH I and Hind III, and the length of the amplified product is expected to be 2886bp.
[0050] 2. Extraction and reverse transcription of BTV1 virus RNA
[0051] Viral genomic RNA was extracted from BHK-21 cells infected with BTV1 by Trizol method as a template, and viral cDNA was synthesized by reverse transcription with BTV1-VP2-Hind-2886-2865R primers.
[0052] RNA extraction step by Trizol method: Harvest BHK-21 cells infected with BTV1 1-5×10 7 Add 1mL Trizol and mix well, let stand at room temperatur...
Embodiment 2
[0082] The preparation of embodiment 2 monoclonal antibody
[0083] 1. Mice Immunization
[0084] Five 6-week-old female BALB / c mice were immunized with the purified prokaryotically expressed recombinant BTV1-VP2 protein for three times with an interval of two weeks between each immunization. The adjuvant was mixed and emulsified, and the recombinant NS1 protein was mixed and emulsified with an equal volume of Freund's incomplete adjuvant for the second and third immunizations. The immunization dose was 50 μg per mouse, and the immunization route was intraperitoneal immunization.
[0085] One week after the second and third immunizations, blood was collected from the tail of the mice, the serum was separated (4°C, 10,000 rpm, 10 min), and the antibody level was detected by indirect ELISA. Three days before cell fusion, BALB / c mice with good immune effect were boosted again.
[0086] 2. Cell Fusion
[0087] Feeder cells were prepared 1 day before fusion, and BALB / c mouse per...
Embodiment 3
[0092] Identification of embodiment 3Mab
[0093] 1. Subclass identification of Mab
[0094] SBA Clonotyping TM System / HRP Antibody Subclass Identification Kit Operating Instructions The Mab obtained in Example 1 was used for subclass identification.
[0095] The results show that the heavy chain of Mab TV1-4B6 of the present invention is IgG 1 , the light chain is a κ chain.
[0096] 2. Western blot identification
[0097] The cell pellet after the centrifugation harvested the BTV1 virus supernatant and the BHK-21 cell pellet were subjected to SDS-PAGE electrophoresis and then electrotransfer. The electrotransfer condition was 17V for 30min. Put the transferred nitrocellulose membrane into PBST blocking solution containing 50g / L skimmed milk powder to block overnight at 4°C; put the blocked nitrocellulose membrane into the supernatant of positive hybridoma culture medium for 1h at room temperature, (pH7.4 PBST buffer containing 0.5mL / L Tween-20) washed 3 times, then rea...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More