Unlock instant, AI-driven research and patent intelligence for your innovation.

Plant expression vector, aphid gene dsRNA expression vector, and application thereof

A plant expression vector and expression vector technology, applied in the direction of plant gene improvement, application, plant products, etc., can solve the problem of increasing the number of beneficial insects in the field

Inactive Publication Date: 2013-09-25
SHIHEZI UNIVERSITY
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition to keeping the soil and water clean, biopesticides also increase the number of beneficial insects in the field due to the reduction in the use of chemical pesticides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant expression vector, aphid gene dsRNA expression vector, and application thereof
  • Plant expression vector, aphid gene dsRNA expression vector, and application thereof
  • Plant expression vector, aphid gene dsRNA expression vector, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1: Preparation of DNA fragments required for vector construction

[0019] carrier ( figure 1 ) DNA fragments such as ToMV CP, ToMV OAS and NOS terminator required for the construction were all obtained by PCR, and the restriction sites required for cloning at both ends were introduced by PCR primers, and the primers used were as follows:

[0020]

[0021] For the amplification of ToMV OAS and ToMV CP, the genomic RNA of ToMV was used as a template, and the primer pairs OAS_F / OAS_R and CP_F / CP_R were used for RT-PCR, respectively. RT-PCR using III One-Step RT-PCR System with (Cat. No. 12574018, Invitrogen) Reagents were completed according to the instructions.

[0022] Amplification of the NOS terminator was carried out by PCR with primers NOS_F / NOS_F using pBI221 as a template. PCR products were separated by agarose gel electrophoresis. The size of the amplification product of the NOS terminator is 272bp, the size of the amplification product of ToMV O...

Embodiment 2

[0024] Embodiment 2: pBiRolCPOAS vector construction

[0025] The digestion products in the following processes were separated by agarose gel electrophoresis, purified with QIAquick Gel Extraction Kit, and DNA fragments were ligated with T4 DNA ligase (promega, catalog number M1801) according to the instructions.

[0026] The construction process of RNAi vector is as follows:

[0027] 1. Cloning the ToMV CP in Example 1 into pBi221 through the restriction endonuclease BamHI / SacI site, and constructing it as a vector p221CP;

[0028] 2. Cut the Rol promoter from the pUC57 vector with BamHI / PstI double enzyme digestion ( Figure 4 ), separated by agarose gel electrophoresis, and recovered, cloned into the BamHI / PstI site of p221CP, and constructed as the vector p221-Rol-CP;

[0029] 3. Cloning the NOS terminator in Example 1 into p221-Rol-CP through the restriction endonuclease HindIII / PstI site, and constructing the vector p221-RolCPNOS;

[0030] 4. Cloning the ToMV OAS in E...

Embodiment 3

[0032] Embodiment 3: pRNAiAV2 vector construction

[0033] This example is a method for constructing a dsRNA expression vector of the cotton aphid V-type proton pump gene (AV2) using the vector pBiRolCPOAS.

[0034] The AV2 gene fragment of cotton aphid was amplified from the cDNA of cotton aphid by designing degenerate primers based on the homologous gene sequence (XM_001950855) of green peach aphid. The amplified fragment was cloned into the pGEM-T easy vector (promega), and the sequence determined by sequencing was SEQ ID NO:1.

[0035] The pRNAiAV2 vector construction process is as follows:

[0036] 1. Use primers AV2_F (CCCGGGTTCATACAGTAAATATACAA) and AV2_R (TCTAGATATAACTGATCAAAGTCAGCACGG) to amplify a partial fragment of AV2, and introduce XmaI and XbaI sites at both ends of the fragment; clone the amplified fragment into the pGEM-T easy vector (promega) for sequencing;

[0037] 2. Use XmaI and XbaI to cut out the AV2 fragment from the T vector in 1., and name it AV2_X...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant expression vector, an aphid gene dsRNA expression vector, and an application thereof for building a dsRNA plant expression vector. A dsRNA sequence is connected with an initial assembly sequence of a tomato masaic virus, so that the transcriptional RNA (ribonucleic acid) molecules can be packaged by coat protein (CP) of ToMV; the plant expression vector also includes an expression frame of a CP gene of ToMV; the encoded CP can package the RNA molecules containing OAS; and the dsRNA encoding sequence and the CP gene sequence are arranged below a promoter for expression of phloem advantage, so that the dsRNA and the CP protein can be accumulated in a sieve tube of a transgenic plant. In the vectors disclosed by the invention, transcription of the dsRNA is driven by a phloem specificity promoter, so that the dsRNA is mainly accumulated in the sieve tube; and the latent pest control objects are aphid, aleyrodid, scale insects and the like fed by piercing-sucking mouthparts.

Description

technical field [0001] The present invention relates to the field of insect double-stranded RNA (dsRNA)-mediated gene silencing. More specifically, the present invention relates to genetic constructs designed to express dsRNA of aphid genes in plants. These constructs can be used to generate transgenic plants that are potentially inhibitory or lethal to aphids that feed on the plants. Background technique [0002] Aphids harm many crops such as cotton, wheat, and rapeseed. Chemical pesticides are currently the main means of control. However, chemical pesticides have side effects. They not only pollute the environment, but also have no specificity. In addition to killing aphids, they can also cause damage to crops and other insects. Chemical pesticides metabolize slowly in the environment, enter the food chain, accumulate in advanced predator species, and become toxic. [0003] Biopesticides are favored because they avoid these dangers of chemical pesticides. For example...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/84A01H5/00
Inventor 崔百明郑银英李晓明高朝宝
Owner SHIHEZI UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More