Gene knockout carrier of fungus C2H2 type zinc finger protein BbAzf and beauveria bassiana BbAzf
A technology of pk2-bbazfl-bar-bbazfr and Beauveria bassiana is applied in the direction of fungi, genetic engineering, plant genetic improvement, etc. It can solve the problems of inability to carry out large-scale production and high cost of artificial synthesis, and achieve improved control effect, the effect of high insecticidal activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] A zinc finger protein with a C2H2 domain was cloned from Beauveria bassiana. The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.
[0038]The amino acid encoded by the sequence has 33-40% homology with known fungal C2H2 zinc finger protein (Asparagine-rich Zinc Finger protein). Therefore, it is presumed that this gene is a new C2H2 zinc finger protein transcription factor in Beauveria bassiana, and it is named BbAzf. Expression of the molecule Bbazf at different stages of fungal development using real-time quantitative PCR. RNA Extraction Kit for Aurum by Bio-Rad TM total RNA mini kit, cDNA synthesis kit is RevertAid from MBI Fermentas TM First Strand cDNA Synthesis Kit. The actin of Beauveria bassiana was used as the internal standard, and the primer sequences were Pact-1:GTCAAGTCATCACCATTGGC and Pact-2:GAGGAGCAATGATCTTGACC. The primer sequences used for Bbazf real-time quantitative PCR detection were Pazfrt-1:CAGCT...
Embodiment 2
[0042] In order to analyze the function of BbAzf, partial sequences (AzfL552bp and AzfR752bp) were selected respectively in the upstream and downstream of the nucleotide sequence of the BbAzf gene as replacement fragments during homologous recombination. The primers for amplifying the BbAzfL fragment are PHrL-up and PHrL-down (PHrL-up: ACTC GAATTCCTCGAG ACTCAAAGAGCTCTTGGTGC, EcoRI and XhoI; PHrL-down: ATGC GAATTC AAAGTCTCTCCATGAGATGC, EcoRI), the primers for amplifying the BbAzfR fragment are (PHrR-up: ATGC TCTAGA TGCTCATGGGAGCAAGAC, XbaI; PHrR-down: ACTG AAGCTTACTAGT AAGAGGGTCACTCTTGAC, SpeI, HindIII) amplification system: 10×Ex Taq PCR Buffer (including Mg2+) 2μl, 10mmol / L dNTP 2μl, 5μmol / L primer 1μl, genomic DNA template 1μl, Ex Taq DNA polymerase 5U / μl0.2μl, Add water to 20μl system. The amplification program is: 94°C, 5min; 94°C, 30s; 56°C, 30s; 72°C, 30s; cycle 30 times; 72°C extension 10min.
[0043] (1) The main construction process is as follows:
[0044] 1)...
Embodiment 3
[0054] Using the wild-type Beauveria bassiana as the transformation recipient, referring to the method of Fang et al. (Fang et al, 2004), the transformation was carried out using the genetic transformation method mediated by Agrobacterium tumefaciens. The medium used and the specific transformation method were as follows:
[0055] (1) Medium used in the transformation process:
[0056] 2.5×MM saline solution (1L): KH 2 PO 4 3.625g,K 2 HPO 4 5.125g, NaCl0.375g, MgSO 4 .7H 2 O1.250g, CaCl 2 .2H 2 O0.165g, FeSO 4 .7H 2 O0.0062g, (NH 4 ) 2 SO 4 1.250g. The medicines are dissolved separately, and stored at room temperature without autoclaving after constant volume.
[0057] IM medium (1L): 400ml 2.5×MM salt solution, 5ml Glycerol, 8.5g MES. Adjust the pH to 5.3, and sterilize at 121°C for 15 minutes.
[0058] M-100 trace element mother solution (500ml): MnCl 2 .4H 2 O30mg, ZnCl 2 200mg,H 3 BO 3 70mg, FeCl 3 .6H 2 O50mg, Na 2 MoO 4 .2H 2 O20mg, CuSO 4 .5H ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


