Gene knockout carrier of fungus C2H2 type zinc finger protein BbAzf and beauveria bassiana BbAzf

A technology of pk2-bbazfl-bar-bbazfr and Beauveria bassiana is applied in the direction of fungi, genetic engineering, plant genetic improvement, etc. It can solve the problems of inability to carry out large-scale production and high cost of artificial synthesis, and achieve improved control effect, the effect of high insecticidal activity

Active Publication Date: 2013-12-04
SOUTHWEST UNIV
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a C2H2-type zinc finger protein gene BbAzf of Beauveria bassiana, which solves the problem that the cost of artificial synthesis is high and large-scale production cannot be carried out

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene knockout carrier of fungus C2H2 type zinc finger protein BbAzf and beauveria bassiana BbAzf
  • Gene knockout carrier of fungus C2H2 type zinc finger protein BbAzf and beauveria bassiana BbAzf
  • Gene knockout carrier of fungus C2H2 type zinc finger protein BbAzf and beauveria bassiana BbAzf

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] A zinc finger protein with a C2H2 domain was cloned from Beauveria bassiana. The nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0038]The amino acid encoded by the sequence has 33-40% homology with known fungal C2H2 zinc finger protein (Asparagine-rich Zinc Finger protein). Therefore, it is presumed that this gene is a new C2H2 zinc finger protein transcription factor in Beauveria bassiana, and it is named BbAzf. Expression of the molecule Bbazf at different stages of fungal development using real-time quantitative PCR. RNA Extraction Kit for Aurum by Bio-Rad TM total RNA mini kit, cDNA synthesis kit is RevertAid from MBI Fermentas TM First Strand cDNA Synthesis Kit. The actin of Beauveria bassiana was used as the internal standard, and the primer sequences were Pact-1:GTCAAGTCATCACCATTGGC and Pact-2:GAGGAGCAATGATCTTGACC. The primer sequences used for Bbazf real-time quantitative PCR detection were Pazfrt-1:CAGCT...

Embodiment 2

[0042] In order to analyze the function of BbAzf, partial sequences (AzfL552bp and AzfR752bp) were selected respectively in the upstream and downstream of the nucleotide sequence of the BbAzf gene as replacement fragments during homologous recombination. The primers for amplifying the BbAzfL fragment are PHrL-up and PHrL-down (PHrL-up: ACTC GAATTCCTCGAG ACTCAAAGAGCTCTTGGTGC, EcoRI and XhoI; PHrL-down: ATGC GAATTC AAAGTCTCTCCATGAGATGC, EcoRI), the primers for amplifying the BbAzfR fragment are (PHrR-up: ATGC TCTAGA TGCTCATGGGAGCAAGAC, XbaI; PHrR-down: ACTG AAGCTTACTAGT AAGAGGGTCACTCTTGAC, SpeI, HindIII) amplification system: 10×Ex Taq PCR Buffer (including Mg2+) 2μl, 10mmol / L dNTP 2μl, 5μmol / L primer 1μl, genomic DNA template 1μl, Ex Taq DNA polymerase 5U / μl0.2μl, Add water to 20μl system. The amplification program is: 94°C, 5min; 94°C, 30s; 56°C, 30s; 72°C, 30s; cycle 30 times; 72°C extension 10min.

[0043] (1) The main construction process is as follows:

[0044] 1)...

Embodiment 3

[0054] Using the wild-type Beauveria bassiana as the transformation recipient, referring to the method of Fang et al. (Fang et al, 2004), the transformation was carried out using the genetic transformation method mediated by Agrobacterium tumefaciens. The medium used and the specific transformation method were as follows:

[0055] (1) Medium used in the transformation process:

[0056] 2.5×MM saline solution (1L): KH 2 PO 4 3.625g,K 2 HPO 4 5.125g, NaCl0.375g, MgSO 4 .7H 2 O1.250g, CaCl 2 .2H 2 O0.165g, FeSO 4 .7H 2 O0.0062g, (NH 4 ) 2 SO 4 1.250g. The medicines are dissolved separately, and stored at room temperature without autoclaving after constant volume.

[0057] IM medium (1L): 400ml 2.5×MM salt solution, 5ml Glycerol, 8.5g MES. Adjust the pH to 5.3, and sterilize at 121°C for 15 minutes.

[0058] M-100 trace element mother solution (500ml): MnCl 2 .4H 2 O30mg, ZnCl 2 200mg,H 3 BO 3 70mg, FeCl 3 .6H 2 O50mg, Na 2 MoO 4 .2H 2 O20mg, CuSO 4 .5H ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to C2H2 type zinc finger protein BbAzf of beauveria bassiana. The C2H2 type zinc finger protein BbAzf has the nucleotide sequence as shown in SEQIDNO.1 and the amino acid sequence as shown in SEQIDNO.2. Oosporein has antibacterial antiviral antineoplastic activity. The yield of the oosporein in the beauveria bassiana can be improved by means of damaging genes of the beauveria bassiana and therefore the obtained beauveria bassiana gene knockout carrier has high toxicity towards agriculture and forestry pests.

Description

technical field [0001] The invention relates to a fungal C2H2 type zinc finger protein BbAzf. [0002] The invention relates to a gene knockout carrier of Beauveria bassiana BbAzf, which contains a herbicide-resistant screening gene Bar. [0003] The invention relates to a knockout mutant of the BbAzf gene of Beauveria bassiana, which can produce a large amount of red pigment—oosporin. Compared with the wild-type strain of Beauveria bassiana, the BbAzf mutant has higher virulence against the agricultural pest Pieris rapae. Background technique [0004] An important aspect of fungal development is the production of secondary metabolites. Although these secondary metabolites are not essential for the growth and development of fungi, they are indispensable for the stability of fungi in the ecological environment or pathogenicity of plants and animals. Some fungal secondary metabolites play an important role in the fields of biotechnology and medicine, displaying broad-spectr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/37C12N15/31C12N15/80C12N15/66C12N1/15A01N63/04A01P3/00C12R1/645
Inventor 范艳华裴炎唐桂荣周永红张永军
Owner SOUTHWEST UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap