Supercharge Your Innovation With Domain-Expert AI Agents!

Application of Bostrycin to preparation of protein tyrodine phosphatase (PTP) bonding agents or inhibitors

A tyrosine phosphatase binder and tyrosine phosphatase technology, which is applied in the field of medicine, can solve the problems of weakened signal pathways and the inability of cells to respond to it, and achieve good therapeutic effects

Inactive Publication Date: 2013-12-18
SUN YAT SEN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Type 2 diabetes, also known as non-insulin-dependent diabetes, occurs when the body produces insulin itself, but the cells are unable to respond to it
At the same time, PTP1B can dephosphorylate insulin receptor substrates IRS1, 2 (IRS-1, IRS-2), and the signaling pathway is thus weakened

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Bostrycin to preparation of protein tyrodine phosphatase (PTP) bonding agents or inhibitors
  • Application of Bostrycin to preparation of protein tyrodine phosphatase (PTP) bonding agents or inhibitors
  • Application of Bostrycin to preparation of protein tyrodine phosphatase (PTP) bonding agents or inhibitors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0125] Fusion expression of human tyrosine phosphatase 1B protein

[0126] (1). The gene cloning of human tyrosine phosphatase 1B is carried out according to the following steps:

[0127] According to the known cDNA sequence of human tyrosine phosphatase 1B, two primers were designed and synthesized (synthesized by Shanghai Yingwei Jieji Trading Co., Ltd.), and the upstream primers were:

[0128] 5’ GGATC CATATG ATGGAGATGGAAAAGGAGTTCGAGC3';

[0129] Downstream primers are:

[0130] 5' AATAT GCGGCCGC ATTGTGTGGCTCCAGGATTCGTTT3'; Add NdeI and NotI restriction sites (underlined parts) to the 5' ends of the upstream and downstream primers, respectively. Using the purchased cDNA cloning vector of human tyrosine phosphatase 1B (purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd.) as a template, use the above two primers to amplify 963 base pairs of human tyrosine by PCR DNA fragment of phosphatase 1B. The PCR reaction conditions are: 0.05 μg of cDNA cloning vector...

Embodiment 2

[0139] The purification of expressing recombinant human tyrosine phosphatase 1B fusion protein comprises the following steps:

[0140] (1). The engineering bacterium expressing human tyrosine phosphatase 1B fusion protein obtained in Example 1 was optimized for protein induction expression: the engineering bacterium expressing human tyrosine phosphatase 1B fusion protein obtained in Example 1 was inoculated into 5 ml containing kanamycin In a test tube of liquid LB culture medium (50 μg / ml), shake culture at 37°C overnight. Then explore the effects of inducer IPTG concentration, induction temperature and induction time on protein production. The above culture was transferred to fresh LB medium containing 50 μg / mL kanamycin at a ratio of 1:100, and cultured with shaking at 200 rpm at 37°C until OD600=0.6. IPTG concentration optimization: add IPTG to the culture to a final concentration of 0.1mM~0.8mM, and continue shaking culture for 4 hours; induction temperature optimizatio...

Embodiment 3

[0147] Identification of Purified Proteins by Western Blot

[0148] SDS-PAGE of ultrafiltration-purified human tyrosine phosphatase 1B fusion protein: take 5 μl of purified ultrafiltration-concentrated human tyrosine phosphatase 1B fusion protein, mix with 2 μl of loading buffer (Thermo company product), boil water Bath for 10 minutes, after cooling, centrifuge and load the sample. Cut filter paper and PVDF membrane of appropriate size, and soak them in transfer buffer and methanol respectively to fully infiltrate them. Put the filter paper, PVDF membrane, and SDS-PAGE glue into the transfer membrane tank in order, and the constant current is 200mA, and the time is 2 hours. The membrane was taken out and placed in blocking solution, and blocked at room temperature for 2 hours. The blocking solution was discarded, and the membrane was washed 3 times with TBST, 10 min each time. Mouse anti-histidine tag (product of Sigma Company) at an appropriate dilution (1:3000) was used a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of medicines, relates to a new application of Bostrycin and in particular relates to an application of Bostrycin to preparation of protein tyrodine phosphatase (PTP) bonding agents or inhibitors. By adopting the method, the PTP dephosphorylation inhibiting activity of Bostrycin is found for the first time. The human PTP1B enzyme activity inhibiting activity IC50 of Bostrycin is 150mu M.

Description

[0001] technical field [0002] The invention relates to the field of medicine, and relates to a new application of Bostrycin, in particular to the application of Bostrycin in the preparation of tyrosine phosphatase binding agents or inhibitors. Background technique [0003] Human tyrosine phosphatase 1B (protein tyrosine phosphatase 1B, PTP1B) is a non-receptor tyrosine phosphatase, a member of the traditional protein tyrosine phosphatase family, which can specifically and specifically catalyze the phosphorylation of polypeptide substrates Amino acid residues are dephosphorylated. In 1988, Tonks et al. isolated and purified PTP1B from human placenta, which was the first member of the protein tyrosine phosphatase family discovered. Later, many achievements in PTP protein regulation, structure and function were discovered based on PTP1B protein research. The PTP1B protein is the cornerstone of phosphatase research. [0004] The cDNA fragment of PTP1B contains 1305 nucl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/122A61P35/00A61P15/14A61P3/10A61P3/04G01N33/52
Inventor 陆勇军陈冬妮何磊佘志刚林永成
Owner SUN YAT SEN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com