Application of Hsa-miR-503 in preparation of drug for treating glioma
A technology of hsa-mir-503 and 1.hsa-mir-503 is applied in the application field of preparing medicines for treating glioma, which can solve the problems of shortened course of disease, increased mortality and unsatisfactory curative effect of patients, and achieves increased apoptosis. death, the effect of reducing proliferation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 qPCR analysis of hsa-miR-503 expression
[0029] (1) Cell lines: U87MG and U251 human malignant glioma cell lines; both cell lines were derived from ATCC.
[0030] Sample preparation: 3 cases of normal brain tissue were obtained from patients with brain contusion in the Department of Brain Surgery, People's Hospital of Wuhan University; 7 cases of malignant glioma were surgical specimens from patients with grade IV glioma after clinical and pathological analysis. provided with the informed consent of the patient. Freeze at -80°C and transport in liquid nitrogen.
[0031] (2) Extraction of total RNA: Trizol reagent was used to extract total RNA from cells and tissues. Trizol reagent was purchased from Invitrogen. The specific steps were as follows:
[0032] 1) Add 1mL Trizol to the cell culture dish, place it on ice for 10min, repeatedly blow and mix with the tip of the pipette, transfer to RNase-free 1.5mL Ep tube; or take 0.1-0.2g fresh tissue in the fume h...
Embodiment 2
[0045] Example 2 Effect of hsa-miR-503 on the proliferation of glioma cells
[0046] The cell proliferation ability was detected by MTT method, and the human glioma cell line U87MG was selected. The control group was transfected with random sequence miR-NC (Negative Control, NC), and the experimental group was transfected with hsa-miR-503 mimics (hsa-miR-503 mimics). Both hsa-miR-503 mimics and random sequences were designed and synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. (hsa-miR-503 mimics sequence is "UAGCAGCGGGAACAGUUCUGCAG").
[0047] (1) Cell inoculation: U87MG cells in the logarithmic growth phase were made into a single cell suspension with DMEM medium containing 10% (v / v) fetal bovine serum, and inoculated into a 96-well cell culture plate with 6000 cells per well , the volume of each well is 100 μL.
[0048] (2) Cell culture and transfection: after 12 hours, the cells adhered to the wall, transfected with 50nmol hsa-miR-503 mimics or NC, and repeated 6 w...
Embodiment 3
[0053] Example 3 Flow cytometric detection of the effect of hsa-miR-503 on U87MG apoptosis
[0054] (1) 50nmol hsa-miR-503 mimics and NC were transfected in U87MG cells respectively (the transfection method was the same as in Example 2), and the medium was changed after 6 hours.
[0055] (2) After 48 hours of transfection, the cells were digested with trypsin and resuspended with ice-cold PBS (0.01M, pH 7.4). Add 5 μL Annexin V-FITC and 10 μL propidium iodide (PI) respectively, and place on ice Let stand in the dark for 10 minutes.
[0056] (3) Detect apoptosis by flow cytometry and analyze the results.
[0057] The result is as image 3 Shown: Compared with the control group, the apoptosis level of U87MG cells transfected with hsa-miR-503 mimics was significantly increased, indicating that hsa-miR-503 can promote the apoptosis of glioma cells.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com