Application of cbf1 gene in improving high temperature tolerance of Trichoderma viride
A technology of Trichoderma viride and high temperature tolerance, which is applied in the field of construction of Trichoderma viride engineering bacteria with CBF1 gene, can solve the problem of lack of stress resistance of Trichoderma viride, improve colonization ability and survival rate, and improve biological control ability , the effect of improving the ability to resist high temperature stress
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] 1. Construction of CBF1 gene cloning and expression vector
[0037] Arabidopsis mRNA was extracted, reverse-transcribed into cDNA, and then used as a template to amplify the CBF1 gene fragment by PCR technology. Primers were designed according to the sequence of the CBF1 gene (GenBank: FJ169262.1) in the NCBI database, and the CACC nucleotide sequence was added before the start codon of the gene to facilitate cloning. Primer pairs are:
[0038] CBF1-F01 CACCATGAACTCATTTTCGACTTT,
[0039] CBF1-R642 TTAGTAACTCCAAAAGTGACACGT
[0040] After the PCR amplification reaction, the obtained target clone CBF1 gene fragment is 642bp in length (see SEQ ID No.1 for the sequence), and the result of PCR product electrophoresis on agarose gel is as follows: figure 1 , Carry out gel cutting recovery and purification of the target fragment. The product was recovered for the next step.
[0041] Gene cloning and vector construction using Gateway TM Cloning Technology (Invitrogen). Th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
