A kind of porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application

A technology for recombinant baculovirus and porcine epidemic diarrhea, applied in genetic engineering, botany equipment and methods, microbial-based methods, etc., can solve the problems of low effective antigen content, low expression level, poor immunogenicity, etc. , to achieve good immunogenicity, high expression level and high expression effect

Inactive Publication Date: 2015-12-02
SOUTH CHINA AGRI UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above expression strategies have disadvantages: the S protein is a glycosylated protein, and the prokaryotic expression system cannot be modified accordingly, resulting in poor immunogenicity of the expressed recombinant S1 protein or M protein; the expression level is generally not high, resulting in an effective antigenic amount The content is too low to prepare subunit vaccines; all of them are expressed in a single way, and the biological activities of S1 protein and M protein are not simultaneously exerted by the dual expression system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application
  • A kind of porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application
  • A kind of porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construction of recombinant vectors Bacmid-S1p-M and Bacmid-S1

[0031] 1. Acquisition of PEDVS1 gene, S1 partial antigen gene and M gene: Design a pair of specific primers according to the gene sequence of PEDV newly isolated strain, the primer sequence is as follows:

[0032] S1-P1: 5'CGGAATTCCAAGATGTCACTAGGTGCCAGTCTA3'

[0033] S1-P2: 5'CCCTCGAGCTATCTAATACTCATACTAAAGTTGGTGGG3'

[0034] M-P1: 5'GAAGGCCTATGCATCACCATCACCATCACGATTA3'

[0035] M-P2: 5'CCAAGCTT TTA GACTAAATGAAGCACTTTCTC3'

[0036] S1p-P1:5'CCCTCGAG ATG GTACTTCTAACACTTAGCCTACCAC3'

[0037] S1p-P2:5'CATGCATGC CTAs AGGATCTGAGGAATTACTGCAAACA3'

[0038] The total RNA was extracted from the positive PEDV disease material, and each downstream primer P2 was used as the specific primer for RT; then the cDNA product was used as the template to amplify the whole S1 gene, S1p (partial epitope of S1 gene) by PCR technology. ) and M gene; wherein the nucleotide sequence of the coding gene S1p of the partial S...

Embodiment 2

[0043] Obtaining of Recombinant Baculovirus Bacmid-S1p-M and Bacmid-S1

[0044] 1.1 Recovery and subculture of Sf9 insect cells

[0045] 2. Transfect Sf9 cells with recombinant Bacmid-S1p-M and Bacmid-S1 plasmids by 2×10 5 Inoculate Sf9 cells on a 12-well cell culture plate at a density of 12, and transfect when the cells grow to 80-90% full, discard the old cell culture medium, and replace it with serum-free Grace cell culture medium; in sterile 1.5 Prepare the following solutions in a mL centrifuge tube: Solution A: Dilute 1.6 μg DNA to 100 μL with GRACE Incomplete Cell Culture Medium; Solution B: Dilute 4.0 μL Lipofectanmine 2000 to 100 μL with GRACE Incomplete Cell Culture Medium; Mix Solution A and B. Stand at room temperature for 20 minutes to form a complex of liposome and DNA; slowly add the complex of liposome and DNA to the cell surface drop by drop (do not discard the nutrient solution); after 4-6 hours, put the transfection solution into the The cell culture medi...

Embodiment 3

[0046] The preparation of embodiment 3 vaccines:

[0047] After the recombinant baculovirus Bacmid-S1p-M and recombinant baculovirus Bacmid-S1 were obtained through Example 2, the M protein and the S1 protein were expressed using a virus expression system. The step is to expand the culture of recombinant baculovirus Bv-S1p-M or recombinant baculovirus Bv-S1, purify and recover to obtain S1 protein or S1p protein and M protein; expand the culture to obtain recombinant baculovirus Bv-S1 with a suitable titer After the virus, when the cells are in the mid-log phase (the density is 1-2×10 6 Cells / mL) were inoculated with infected cells, and the insect cells were cultivated under serum-free conditions, which would facilitate the purification of the target protein in the later stage. However, generally according to needs, 0.1-0.5% FBS or BSA should be added at the late stage of infection to protect the recombinant protein from hydrolysis. After the cells were inoculated with the r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological vaccine preparation, in particular to a porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application. The present invention selects the S1 gene and M gene of the current new epidemic strain of PEDV as the reference sequence, uses the baculovirus expression system to express the S1 protein or part of the S1 protein and M protein, and prepares the obtained recombinant protein into a subunit vaccine for effective Control the occurrence of porcine epidemic diarrhea. The porcine epidemic diarrhea genetically engineered subunit vaccine prepared by the method of the present invention solves the defects of the current porcine epidemic diarrhea virus traditional vaccine, can be used to prevent and treat porcine epidemic diarrhea virus infection and related diseases caused by it, and can also It is also suitable for preparing the coating antigen of the ELISA kit for detecting porcine epidemic diarrhea virus antibody.

Description

technical field [0001] The invention belongs to the technical field of biological vaccine preparation, in particular to a porcine epidemic diarrhea recombinant baculovirus genetically engineered subunit vaccine and its preparation method and application. Background technique [0002] Porcine epidemic diarrhea (Porcineepidemicdiarrhea, PED) is an acute highly contagious intestinal infectious disease caused by porcine epidemic diarrhea virus (Porcineepidemicdiarrheavirus, PEDV), and its clinical features are watery diarrhea, vomiting and dehydration. Pigs of all ages are susceptible, especially suckling piglets. PED is widely distributed in the world, the United Kingdom, Belgium, France, Hungary, Canada and other countries have reported the occurrence of this disease. According to reports, PED has occurred quite seriously in Asian countries in recent years. Japan, South Korea, and Thailand have all experienced pandemics, and the mortality rate is high and the harm is serious,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K39/215C12N15/50C12N15/86A61P31/14C12R1/93
Inventor黄毓茂谭博敏项林盛
OwnerSOUTH CHINA AGRI UNIV