Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Npro207shRNA for inhibiting classical swine fever virus replication and preparation method thereof

A technology of swine fever virus and lentivirus, applied in the field of preparation of Npro207shRNA

Inactive Publication Date: 2014-03-26
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still many questions about RNAi to be resolved, such as: the time and target site of RNAi; the interferon response in mammals; the exact mechanism of RNAi; off-target effects, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Npro207shRNA for inhibiting classical swine fever virus replication and preparation method thereof
  • Npro207shRNA for inhibiting classical swine fever virus replication and preparation method thereof
  • Npro207shRNA for inhibiting classical swine fever virus replication and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] 1. Generation of ds oligo expressing Npro207shRNA

[0042] With the help of the online design software (BLOCK-iT) of Invitrogen Company of the United States TM RNAi Designer), determine the DNA insertion sequence corresponding to the specific shRNA fragment 207 required by the pEN / U6 vector, and send it to Yubao Bioengineering (Dalian) Co., Ltd. for synthesis and annealing to generate ds oligo. The insertion sequence is as follows:

[0043] Npro207: 5'→3'

[0044] SEQ ID NO: 1: TCACCGCCCACTATTAGGCTAGTATACGA

[0045] ATATACTAGCCTAATAGTGGGC

[0046] SEQ ID NO: 2: BAAAAGCCCACTATTAGGCTAGTATATTCG

[0047] TATACTAGCCTAATAGTGGGC

[0048] 2. ds oligo is connected with pEN / U6 vector to construct pEN / U6-shRNA

[0049] 2.1 Generation of double-stranded oligonucleotide (ds oligo)

[0050] (1) Establish the following system in a 0.2ml PCR amplification tube:

[0051]

[0052] (2) Incubate the above reaction at 95°C for 4 minutes, and then pl...

Embodiment 2

[0081] 1-6 steps are the same as embodiment 1

[0082] 7. Preparation of sample 2

[0083] Pig whole blood infected with classical swine fever virus was collected, centrifuged at 12,000 rpm and 4°C for 30 minutes, and the supernatant was filtered through a 0.22um filter membrane and then inoculated with PK-15 cells. For details of the inoculation method, see 7 in Example 1.

[0084] 8. Detection of the ability of Npro207shRNA to inhibit the expression of CSF whole blood virus by indirect immunofluorescence

[0085] In order to verify that the positive PK-15 cell clones expressing Npro207shRNA inhibited the packaging ability of classical swine fever virus, the positive PK-15 cell clones screened were inoculated with the CFSV cytotoxicity cultured in step 7. After culturing for 24 hours, discard the culture medium, wash the cells twice with PBS buffer (pH7.6), 1.5 minutes each time, add pre-cooled 80% acetone after washing, put them in a -20°C refrigerator for 25 minutes, and d...

Embodiment 3

[0089] 1-7 steps are the same as embodiment 2

[0090] 8. Real-time RT-PCR verifies the inhibitory effect test of Npro207shRNA on the replication of swine fever whole blood virus, the method is the same as that of Example 1.

[0091] 9. Results

[0092] Compared with pU6-shRNA-CON and non-transgenic normal cells, the relative copy number of pU6-shRNA-207 virus gene was lower, indicating that the interference group showed a strong ability to inhibit virus infection. see attached Figure 5 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to Npro207shRNA for inhibiting classical swine fever virus replication, which comprises an siRNA sequence. By establishing an shRNA lentiviral vector, replication-defective lentiviruses are obtained, PK-15 cells ( porcine kidney cells ) are infected by the obtained lentiviruses, and an authentication method of a classical swine fever virus replication inhibiting effect is conducted. The sequence has an effect of obviously inhibiting the replication of classical swine fever viruses on sensitive cells. The RNA interference to the in vivo and vitro replication of the classical swine fever viruses is explored, a lentiviral vector-mediated stably integrated RNA interference technology of a specific conserved gene segment targeted to a classical swine fever virus genome is established, and a transgenic animal with siRNA targeted to the classical swine fever viruses is expected to be established. The necessary experimental data is accumulated for the gene function research of shRNA applied to the classical swine fever viruses and the prevention of classical swine fever, and the early preparation for breeding for disease resistance of the animals is provided.

Description

[0001] This application is a divisional application of "application date: June 4, 2012, application number: 201210180327.2, name: RNAi for inhibiting the replication of classical swine fever virus and its preparation method". technical field [0002] The present invention relates to the method for inhibiting the replication of classical swine fever virus, specifically a kind of Npro207shRNA (Npro nucleoprotein precursor, short hairpin RNA is short hairpin deoxyribonucleic acid) that is used to inhibit the replication of classical swine fever virus, the present invention also includes the Npro207shRNA Preparation. Background technique [0003] Classical swine fever (CSF) is one of the infectious diseases that seriously endanger the swine industry worldwide. In order to distinguish it from African swine fever, Europeans call it "Classical swine fever (CSF)". The pathogen is classical swine fever virus (CSFV). CSFV is an RNA virus belonging to the Flaviridae family (Flavirida...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867
Inventor 刘湘涛陈妍田宏吴锦艳尚佑军尹双辉王光祥靳野张克山杨顺利刘永杰
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com