Recombinant protein for resisting porcine pseudorabies virus reproduction and application thereof
A porcine pseudorabies virus and recombinant protein technology, applied in the field of genetic engineering, can solve the problems of disease re-epidemic, immunosuppression, unsatisfactory immune protection response of vaccine strains, etc., and achieve a significant inhibitory effect.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1 Bioinformatics analysis Design protein molecules and related genes for their synthesis.
[0046] The N-terminal domain of protein kinase R (protein kinase R, PKR) contains two dsRNA binding domains; the C-terminal has a kinase domain. After binding dsRNA, PKR protein phosphorylates eIF-2alpha after autophosphorylation, which then prevents the translation of viral proteins. Apoptotic protease activating factor 1 (Apaf-1) can simultaneously bind many procaspases. These procaspases activate themselves by cleavage, which then enzymatically cleaves many cellular proteins, thereby killing the cell. When the dsRNA-binding domains and procaspases-binding domains of these two factors are combined into a fusion protein, cells transfected with the protein can immediately initiate the apoptosis process when encountering dsRNA.
[0047] Retrieve the porcine PKR gene (gi|47523704) and Apaf-1 gene (gi|350584646) on NCBI, analyze their domains, and take the dsRNA binding do...
Embodiment 2
[0050] Embodiment 2 expresses and purifies this protein with prokaryotic expression vector pET-28a
[0051] The gene was amplified using a pair of primers as follows:
[0052] sDRACO-1:GACGGGCCGAAGCTTGCTATG
[0053] sDRACO-2:GATCCGACGTCTTAGGAAGAAG
[0054] The cloned gene was connected to the pMD18-T vector, digested by HindIII and XhoI and then connected to the pET-28a expression vector. After the sequence verification was correct, it was transformed into a BL21 expression strain. After IPTG induced expression, SDS-PAGE confirmed the successful expression ( figure 1 ). Continue to analyze the solubility of the recombinant protein: the recombinant strain was induced to express with IPTG, ultrasonically crushed, centrifuged, the supernatant and precipitate were collected, and the solubility of the protein was analyzed. The results of SDS-PAGE showed that at 34.5KD, both the supernatant and the precipitate had a band ( figure 2 ). Cultivate 350ml of the recombinant strain...
Embodiment 3
[0055] Example 3 Cell experiments confirmed that the protein (sDRACO) has the ability to significantly inhibit the proliferation of porcine pseudorabies virus
[0056] Proceed as follows:
[0057] 1) The cells cultured for 48 hours into a good monolayer were digested into single cells by trypsin, spread on a 96-well plate, and the antiviral experiment was carried out when the cells grew to 50-80%;
[0058] 2) Do a series of 10-fold dilutions of the PRV virus;
[0059] 3) Antiviral experiment: the experimental group was added with sDRACO and PRV at the same time, and the control group was added with the same amount of PBS and PRV;
[0060] 4) Observe and record the time of cell lesion and the number of holes;
[0061] When the virus was added at a dose of 10 11.5 When TCID50, some cells did not have pathological changes, while all cells in the corresponding control group were pathological ( image 3 ).
[0062] The virus in each well was collected separately, the viral DNA...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com