Red cone ssr1 marker, primer pair, preparation method and application thereof
A primer pair and red cone technology, which is applied in biochemical equipment and methods, DNA preparation, microbial measurement/inspection, etc., can solve the problems of poor stability, inability to directly apply molecular marker-assisted breeding and QTL mapping, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0028] Extraction and enzyme digestion of total DNA of red cone
[0029] Select the young leaves of Red Cone, and use CTAB method to extract the nuclear genome; digest with EcoRV at 37°C for 3 hours, and inactivate the endonuclease at 65°C for 20 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;
[0030] Connection of connector
[0031] Connect the red cone genomic DNA digested by step EcoRV to the upper and lower adapters (the upper adapter sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, the sequence table SEQ.ID.No.4; the lower adapter sequence ACCAGCCC-NH 2 , sequence table SEQ.ID.No.5); 60 μL ligation system contains 9 μL enzyme-digested red cone genomic DNA, 100 pmol each of the upper and lower joints; the ligation reaction is carried out under the condition of 1 times T4 ligase buffer, and ligated overnight at 16°C; The final mixture was reacted at 65°...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 