Primer pair, castanopsis hystrix SSR8 (Simple Sequence Repeat 8) marker and preparation method and application thereof
A primer pair, red cone technology, applied in biochemical equipment and methods, DNA preparation, microbial assay/inspection, etc., can solve problems such as inability to directly apply molecular marker-assisted breeding and QTL positioning, poor stability, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Extraction and enzyme digestion of total DNA of red cone
[0029] Select the young leaves of Red Cone, and use CTAB method to extract the nuclear genome; digest with EcoRV at 37°C for 3 hours, and inactivate the endonuclease at 65°C for 8 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL of EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;
[0030] Connection of connector
[0031] Connect the red cone genomic DNA digested by step EcoRV to the upper and lower adapters (the upper adapter sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, the sequence table SEQ.ID.No.4; the lower adapter sequence ACCAGCCC-NH 2 , sequence table SEQ.ID.No.5); the 20 μL ligation system contains 4 μL of enzyme-digested red cone genomic DNA, and 100 pmol of the upper and lower adapters; the ligation reaction is performed under T4 ligase buffer conditions (T4 ligase 1.0 μL, ligase buffer2. 0 μL), ligated at 16°C overnight; react...
Embodiment 2
[0044] Extraction and enzyme digestion of total DNA of red cone
[0045] Select the young leaves of Red Cone, and extract the nuclear genome by CTAB method; use EcoRV to digest at 37°C for 8 hours, and inactivate the endonuclease at 65°C for 14 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL of EcoRV endonuclease, 2 μL of DNA, 15.0 μL of sterilized double distilled water;
[0046] Connection of connector
[0047] Connect the red cone genomic DNA digested by step EcoRV to the upper and lower adapters (the upper adapter sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, the sequence table SEQ.ID.No.4; the lower adapter sequence ACCAGCCC-NH 2 , sequence table SEQ.ID.No.5); the 20 μL ligation system contains 4 μL of enzyme-digested red cone genomic DNA, and 100 pmol of the upper and lower adapters; the ligation reaction is performed under T4 ligase buffer conditions (T4 ligase 1.0 μL, ligase buffer2. 0 μL), ligate overnight at 16°C; react t...
Embodiment 3
[0060] Extraction and enzyme digestion of total DNA of red cone
[0061] Select the young leaves of Red Cone, and extract the nuclear genome by CTAB method; use EcoRV to digest at 37°C overnight, and inactivate the endonuclease at 65°C for 20 minutes; the reaction system is 20 μL, including 2.0 μL of 10×Buffer, 1.0 μL EcoRV endonuclease, 2 μL DNA, 15.0 μL sterilized double distilled water;
[0062] Connection of connector
[0063] Connect the red cone genomic DNA digested by step EcoRV to the upper and lower adapters (the upper adapter sequence GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT, the sequence table SEQ.ID.No.4; the lower adapter sequence ACCAGCCC-NH 2 , sequence table SEQ.ID.No.5); the 60 μL ligation system contains 9 μL of enzyme-digested red cone genomic DNA, and 100 pmol of the upper and lower joints; the ligation reaction is performed under T4 ligase buffer conditions (T4 ligase 2.0 μL, ligase buffer2. 0 μL), ligated overnight at 16°C; reacted the ligated...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


