Identification method of bacillus subtilis with high protease output
A Bacillus subtilis, identification method technology, applied in the field of bacterial strain identification, can solve the problems of unscientific identification method, low strain selectivity, long time period, etc., and achieve the effects of scientific identification method, strong selectivity, and short time period
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0016] The identification method of the high-production protease Bacillus subtilis of the present embodiment comprises the following steps:
[0017] 1. Morphological identification, take the strain to be tested and inoculate it on a plate medium of skimmed milk powder for 24 hours at 35°C, then perform Gram staining and microscopic examination;
[0018] 2. PCR identification, take 1.0ml of the strain to be tested and extract the DNA template with a genomic DNA extraction kit, design and synthesize PCR amplification primers, upstream primer P1: 5'- AGAGTTTGATCCTGGCTCAG -3'; downstream primer P2: 5'- AGTAAGGAGGTGATCCAACCGCA - 3', carry out PCR amplification of 16S rDNA, the PCR reaction conditions are: 94°C pre-denaturation for 10 min, then 94°C denaturation for 1 min, 54°C annealing for 1 min, 72°C extension for 2 min, a total of 25 cycles, and finally 72°C extension for 10 min.
[0019] After the PCR product was purified, it was connected to the cloning vector and transformed....
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap