Unlock instant, AI-driven research and patent intelligence for your innovation.

Identification method of bacillus subtilis with high protease output

A Bacillus subtilis, identification method technology, applied in the field of bacterial strain identification, can solve the problems of unscientific identification method, low strain selectivity, long time period, etc., and achieve the effects of scientific identification method, strong selectivity, and short time period

Inactive Publication Date: 2014-06-25
QINGDAO ZHONGREN PHARMA
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In order to overcome the above-mentioned defects existing in the prior art field, the object of the present invention is to provide a method for identification of high-yield protease Bacillus subtilis, which solves the problem of low selectivity to bacterial strains in the prior art, unscientific identification methods, long time period and low efficiency. The problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0016] The identification method of the high-production protease Bacillus subtilis of the present embodiment comprises the following steps:

[0017] 1. Morphological identification, take the strain to be tested and inoculate it on a plate medium of skimmed milk powder for 24 hours at 35°C, then perform Gram staining and microscopic examination;

[0018] 2. PCR identification, take 1.0ml of the strain to be tested and extract the DNA template with a genomic DNA extraction kit, design and synthesize PCR amplification primers, upstream primer P1: 5'- AGAGTTTGATCCTGGCTCAG -3'; downstream primer P2: 5'- AGTAAGGAGGTGATCCAACCGCA - 3', carry out PCR amplification of 16S rDNA, the PCR reaction conditions are: 94°C pre-denaturation for 10 min, then 94°C denaturation for 1 min, 54°C annealing for 1 min, 72°C extension for 2 min, a total of 25 cycles, and finally 72°C extension for 10 min.

[0019] After the PCR product was purified, it was connected to the cloning vector and transformed....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an identification method of bacillus subtilis with a high protease output. The method includes: inoculating a bacterial strain to be identified onto a skim milk powder plate culture medium, culturing at 35 DEG C for 24 h, performing Gram staining, performing microscopic examination, separately extracting a DNA template from 1.0 mL of the bacterial strain to be identified by adoption of a genome DNA extraction solvent kit, designing and synthesizing PCR amplification primers, with the upstream primer P1 being 5'-AGAGTTTGATCCTGGCTCAG-3' and the downstream primer P2 being 5'-AGTAAGGAGGTGATCCAACCGCA-3', and performing PCR amplification of 16SrDNA. The method is high in bacterial strain selectivity, scientific in identification method, short in time and period and high in efficiency.

Description

[0001] technical field [0002] The invention belongs to the field of biotechnology, and in particular relates to an identification method for bacterial strains. [0003] Background technique [0004] There are many kinds of enzymes that catalyze protein hydrolysis, the important ones are pepsin, trypsin, cathepsin, papain, subtilisin and Bacillus licheniformis protease. Protease has strict selectivity to the reaction substrate it acts on. A protease can only act on certain peptide bonds in protein molecules, such as the peptide bond formed by trypsin catalyzing the hydrolysis of basic amino acids. Proteases widely exist in animal viscera, plant stems and leaves, fruits and microorganisms. Microbial proteases are mainly produced by molds and bacteria, followed by yeasts and actinomycetes. [0005] The methods for identifying Bacillus subtilis in the prior art generally have the problems of low selectivity to bacterial strains, unscientific identification methods, long tim...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
CPCC12Q1/686C12Q1/04
Inventor 张述智夏伟朱绍辉张浩王晓丽徐权汗李之详许团辉
Owner QINGDAO ZHONGREN PHARMA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More