Simple, convenient, sensitive and general gene detecting method
A gene detection, general-purpose technology, applied in the field of functional nanomaterials and biochemistry, can solve the problems of complex operation and limited sensitivity of gene detection methods, and achieve the effect of high application potential, high yield and long life.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: A Simple, Sensitive and Universal Gene Detection Method
[0043] The detection method of the concentration of the target gene to be tested can be found in figure 1 shown. In this embodiment, an artificially synthesized DNA is used as the target gene to be tested.
[0044] In the first step, the DNA probe sequence is designed according to the target gene sequence to be tested, and the DNA (sequence is 5'- GGTCGGTGCAAAGATACGTACG AGGACA-3') as the target gene to be tested, design probes (sequence is 5'-GCTTTGA CGTACGTATCTTTGCACCGACC -3'), while DNA containing a single mutant base (sequence is 5'- GGTCGGTGCAAAGCTACGTACG AGGACA-3') as a control, where the bold letter in the probe sequence is the stem structure, which contains T-T base pairs, the underlined part is the pairing region between the probe and the target gene to be tested, and the bold and italic letter C is a single mutation base;
[0045] In the second step, mix the probe (containing three T-T...
Embodiment 2
[0051] Example 2: A Simple, Sensitive and Universal Gene Detection Method
[0052] A simple, sensitive and universal genetic detection method includes the following steps:
[0053] In the first step, the DNA probe sequence is designed according to the target gene sequence to be tested, and the HIV-1 DNA (sequence is 5'- AGAAGATATTTGGAATAACATGACCTGGATGCA -3') as the target gene to be tested, design a probe (sequence is 5'-TGGTTTTA TGCATCCAGGTCATGTTATTCCAAATATCTTCT -3'), while using a completely mismatched DNA (sequence 5'-CTAGCTGCATCCCGACGATCGAAGAGTCTGATC-3') as a control, where the bold letters in the probe are the stem structure, which contains T-T base pairs, and the underlined part is the probe and The paired region of the target gene to be tested;
[0054] In the second step, the DNA probe (containing three T-T base pairs) was mixed with mercuric nitrate in a molar ratio of 1:3 at room temperature and allowed to stand for 10 minutes, so that the T-T base pairs and diva...
Embodiment 3
[0060] Example 3: A Simple, Sensitive and Universal Gene Detection Method
[0061] A simple, sensitive and universal genetic detection method includes the following steps:
[0062] In the first step, the DNA probe sequence is designed according to the target gene sequence to be tested, and P53exon8DNA (sequence is 5'-CCTCTGTGCGC CGGTCTCTCCCAGGACAGGCA -3') As the target gene to be tested, design a DNA probe (sequence is 5'- TGCCTGTCCTGGGAGAGACCG TCTGGCT-3'), and R282W p53exon8DNA containing a single mutant base (the sequence is 5'-CCTCTGTGCGC CAGTCTCTCCCAGGACAGGCA -3') as a control, where the bold letter in the probe sequence is the stem structure, which contains T-T base pairs, the underlined part is the pairing region between the probe sequence and the target gene to be tested, and the letter A in bold and italics is a single mutation base;
[0063] In the second step, the DNA probe (containing three T-T base pairs) and mercury hypochlorite were mixed in a molar ratio o...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap