Method for preparing detection kit based on penicillin-binding protein PBP6 beta-lactam antibiotic receptor assay and detection method thereof
A detection kit and protein-binding technology, applied in the biological field, can solve the problems of β-lactam drug leakage and other problems, and achieve the effects of high sensitivity, overcoming leakage, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1. Preparation method of the β-lactam antibiotic receptor method detection kit for penicillin-binding protein PBP6
[0052] 1) Construction of recombinant expression vector of penicillin-binding protein 6 and protein expression The sequence of penicillin-binding protein 6 was derived from Genebank (No. P08506.2) or other homologous sequences. Primers, introducing enzyme cutting sites NdeI and XhoI in the primers, the primer sequences are as follows:, upstream primer P1: 5'GGAATTC CATATG GCGGAACAAACCGTT 3'
[0053] Downstream primer P2: 5'CCG CTCGAG TTAAGAGAACCAGCTGCCGA 3’
[0054] PCR amplification was performed using the synthesized gene as a template. The amplification procedure was as follows: pre-denaturation at 94°C for 2 minutes, denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute and 30 seconds, 30 cycles, and extension at 72°C for 5 minutes. The amplified product was electrophoresed on a 1% agarose g...
Embodiment 2
[0081] Example 2. Indirect competitive receptor method detection method for the content of β-lactam drugs in milk
[0082] Taking the milk sample as an example, there is no need for any pretreatment during the detection, and it can be directly spotted on the microtiter plate. Specific steps are as follows:
[0083] (1) Add standard / sample: Use a pipette to draw 50 μl of sample or standard into the microtiter plate in the air, shake gently and place it on a horizontal table.
[0084] (2) Add penicillin-binding protein 6: continue to add 50 μl of penicillin-binding protein 6 solution, shake the microtiter plate gently, and mix the solutions therein evenly;
[0085] (3) Adding enzyme-labeled monoclonal antibody: After adding the enzyme-labeled substance into the wells of the microplate at 50 μl per well, gently shake the microplate to mix the solutions evenly;
[0086] (4) Incubation and plate washing: Cover the microplate with a cover film and place it in a 37°C incubator for ...
Embodiment 3
[0090] Embodiment 3, the accuracy and precision test of kit
[0091] Take 20 blank milk samples, add penicillin G standard to it to make the concentration reach 4 μg / L, use the prepared β-lactam receptor method kit to operate according to the operating instructions, and detect the penicillin G content therein. The sample recovery rate was calculated as the measurement result of accuracy, and the coefficient of variation of the measurement result was used as the precision of the kit. The specific measurement results are shown in the table below.
[0092] Table 1 Measurement results of accuracy and precision
[0093] Sample serial number
[0094] It can be seen from the table that when the kit detects milk samples with the addition of 4 μg / L penicillin G, the recovery rate is 67.5%-107.5%, the average recovery rate is 90.3%, and the coefficient of variation is 13.9%.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap