Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof

A technology of genetically engineered bacteria and reductase, applied in the fields of genetic engineering, oxidoreductase, application, etc.

Inactive Publication Date: 2015-01-07
ZHEJIANG UNIV OF TECH
View PDF8 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To date, the use of carbonyl reductases from Burkholderia gladioli strains in the asymmetric reduction of these pharmaceutical chiral intermediates has not been seen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof
  • Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof
  • Carbonyl reductase gene, codase, vector, engineering bacterium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Amplification of the carbonyl reductase gene adh2

[0046] According to the whole genome sequencing information of Burkholderia gladioli (Burkholderia gladioli) ZJB-12126, a large number of carbonyl reductases were excavated, one of which has the ability to catalyze 2-benzamidomethyl-3-ketobutyrate and N,N-Dimethyl-3-oxo-3-(2-thienyl)propionamide generates (2S,3R)-2-benzamidomethyl-3-hydroxybutyrate and (S)-N , N-bismethyl-3-hydroxyl-3-(2-thienyl) propanamide functional enzyme is the carbonyl reductase BgADH2 involved in the present invention.

[0047] Using MPBio's Spin kit extracts the total genomic DNA of Burkholderia gladioli (Burkholderia gladioli) ZJB12126 cells, and uses the genomic DNA as a template to carry out PCR under the action of primer 1 (ATGAGCAAGCGGCTGGAAGGCAAGG) and primer 2 (TCAGACCTGGGCCTGGC CGCC) Amplify. PCR reaction system (total volume 50 μL): 5 μL of 10×Pfu DNA Polymerase Buffer, 1 μL of 10 mM dNTP mixture (2.5 mM each of dATP, dC...

Embodiment 2

[0050] Embodiment 2: Construction of recombinant Escherichia coli BL21(DE3) / pET28a-adh2

[0051] Design primer 3 according to embodiment 1 analysis result ( CATATG AGCAAGCGGCTGGAAGGCAA GG), primer 4 ( CTCGAG TCAGACCTGGGCCTGGCCGCCG), and Nde I and Xho I restriction enzyme sites (underlined) were introduced into primer 3 and primer 4, respectively. Under the priming of primer 3 and primer 4, high-fidelity Pfu DNA polymerase was used to amplify to obtain a 756bp carbonyl reductase gene sequence (its nucleotide sequence is shown in SEQ ID NO: 1), and after sequencing, use The amplified fragment was treated with Nde I and Xho I restriction endonucleases (TaKaRa), and the fragment was treated with the commercial vector pET28a (Invitrogen) treated with the same restriction enzymes using T4 DNA ligase (TaKaRa). Connection to construct the expression vector pET28a-adh2. The constructed expression vector pET28a-adh2 was transformed into Escherichia coli BL21(DE3) (Invitrogen), sprea...

Embodiment 3

[0052] Embodiment 3: Recombinant carbonyl reductase (BgADH2) wet thallus

[0053] The recombinant Escherichia coli E.coli BL21(DE3) / pET28a-adh2 bacterial cell containing the expression recombinant plasmid pET28a-adh2 obtained in Example 2 was inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance, Cultivate at 37°C for 12 hours at 200rpm, then inoculate with 1% inoculum size (v / v) into fresh LB liquid medium containing kanamycin resistance at a final concentration of 50 μg / ml, and cultivate at 37°C at 150rpm until Cell OD 600 After reaching 0.6-0.8, add IPTG with a final concentration of 0.1mM, induce culture at 28°C for 12h, centrifuge at 5000rpm at 4°C for 5min, discard the supernatant, collect the precipitate, and obtain recombinant Escherichia coli BL21( DE3) / pET28a-adh2 wet cells. The bacterium can be used directly as a biocatalyst or for protein purification.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant carbonyl reductase derived from Burkholderia gladioli ZJB-12126 and a coding gene thereof, a recombinant vector containing the gene, a recombinant gene engineering bacterium converted from the recombinant vector and application in preparing the recombinant carbonyl reductase.2-benzoylaminomethyl-3-one butyrate, N,N-bis-methyl-3-one-3-(2-thienyl)propanamide, ethyl 4-chloroacetoacetate (COBE) and tert-butyl (R)-6-cyano-5-hydroxy-3-carbonylhexanoate used as substrates are subjected to biological catalytic reaction to prepare high-optical-purity (2S,3R)-2-benzamidomethyl-3-hydroxybutyrate, (S)-N,N-bis-methyl-3-hydroxy-3-(2-thienyl)propanamide, ethyl (S)-4-chloro-3-hydroxybutyrate and tert-butyl 6-cyano-(3R,5R)-dihydroxyhexanoate.

Description

(1) Technical field [0001] The present invention relates to a carbonyl reductase gene derived from Burkholderia gladioli (Burkholderia gladioli) ZJB-12126, an encoding enzyme, a recombinant vector containing the gene, a recombinant genetically engineered bacterium obtained by transforming the recombinant vector and Application in the preparation of chiral pharmaceutical intermediates. (2) Background technology [0002] Carbonyl reductase (E.C.1.1.1.184) belongs to the oxidative cyclooxygenase family, and the reaction requires the participation of the coenzyme NAD(P)H, which can stereoselectively catalyze the asymmetric reduction of latent chiral ketones to optical chiral alcohol intermediates. This type of enzyme is widely distributed in nature and is found in various animals, microorganisms and plants. Among them, due to the wide variety and wide distribution of microorganisms, they are the main source of carbonyl reductase. Carbonyl reductases have been found from a vari...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12N1/21C12P13/02C12P17/00C12P7/62C12R1/19
Inventor郑裕国柳志强陈翔王亚军沈寅初
OwnerZHEJIANG UNIV OF TECH