Blood coagulation factor VIII fusion protein as well as preparation method and use thereof

A technology of eight coagulation factors and fusion protein, which is applied in the field of eight coagulation factors fusion protein and its preparation to achieve the effect of reducing ADCC effect function and improving in vitro biological activity

Active Publication Date: 2015-01-21
SYNDEGEN SHANGHAI BIOTECH
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the half-life of the modified eight-factor Fc fusion protein has not been greatly improved, this treatment plan has approximately doubled the treatment interval for patients with hemophilia A, but the total dosage of the patient has not changed, and the burden of medication for the patient has not changed. reduce

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Blood coagulation factor VIII fusion protein as well as preparation method and use thereof
  • Blood coagulation factor VIII fusion protein as well as preparation method and use thereof
  • Blood coagulation factor VIII fusion protein as well as preparation method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] Embodiment 1 obtains the fusion gene sequence of coding fusion protein

[0085] The six fusion proteins F8-L1-Fc, F8-L2-Fc, F8-L3-Fc, F8-L4-Fc, F8-L5-Fc, and F8-L6-Fc corresponding to each of the six fusion proteins of the present invention were obtained as follows: Gene sequence encoding DNA:

[0086] Using the cDNA missing factor 8 in region B as a template, the gene sequence of factor 8 missing in region B was amplified by PCR (and the translation stop codon at the C-terminus of the gene sequence missing factor 8 in region B was mutated into BamHI). Points are XbaI, BamHI. The upstream primer is tggtgaactctctagaccca (SEQ ID NO. 21), and the downstream primer is tggtgaactctctagaccca (SEQ ID NO. 22).

[0087] Using IgG4 cDNA as a template, the IgG4 Fc gene sequence containing different connecting peptides was obtained by PCR amplification, and the restriction sites at both ends were BamHI and MluI. in,

[0088] The upstream primer for amplifying the IgG4 Fc gene se...

Embodiment 2

[0104] Example 2 Construction of expression vector

[0105] The invention adopts the double-plasmid co-transfection method to introduce the fusion gene encoding the fusion protein into the host cell for expression. Therefore, a dual-plasmid expression vector was constructed first.

[0106] The specific method is: the eight-factor Fc fusion protein coding sequence (fusion gene) obtained in Example 1 is cloned simultaneously into two pIRES-DHFR (abbreviated as pID) expression vectors respectively, and the cloning sites used are respectively NheI and MluI. The first plasmid expresses a simple Fc sequence under the drive of the CMV promoter (that is, the Fc sequence without the deletion of eight factors in the B region), that is, the IgG1-Fc of Eloctate or the IgG4-Fc of each fusion protein of the present invention (S228P, L235E, L445P ) sequence to construct the pID-Fc expression vector; the second plasmid is also driven by the CMV promoter to express the Fc sequence containing...

Embodiment 3

[0107] Example 3 Establishment of CHO Engineering Cell Line

[0108] The above expression vectors were amplified using Escherichia coli. After the plasmid was extracted, the two expression vectors pID-Fc and pID-8Fc were co-transfected into CHO-DXB11 cells by liposome transfection method for expression.

[0109] The specific method is: in a 6-well plate, CHO-DXB11 blank cells are passaged into a 6-well plate at a ratio of 1:10. Since the CHO-DXB11 cells are DHFR gene-deleted, DMEM medium containing 10% FBS and 1xHT is required for the process. nourish. Transfection experiments were performed when the cell confluency reached 90%. First remove the cell culture medium and add 2 ml of fresh FBS+HT medium to each well. Mix 2 micrograms of pID-Fc plasmid with 12 micrograms of pID-8Fc plasmid, then dilute the obtained 14 micrograms of mixed plasmid DNA to 150 microliters of DMEM medium, and dilute 12 microliters of Lipofectamine reagent to 150 microliters of DMEM medium. Plasmid ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a blood coagulator factor VIII fusion protein as well as a preparation method and a use thereof. The fusion protein comprises a block B-missing blood coagulator factor VIII, a connecting peptide and a human IgGFc variant. In the blood coagulator factor VIII fusion protein, the specifically designed connecting peptide is added between the block B-missing blood coagulator factor VIII and the human IgGFc variant, so that an Fc area is far away an enzyme activity center of a blood coagulator factor VIII molecule, and thus, the in-vitro biological activity of the fusion protein is improved; moreover, the human IgGFc variant contains amino acid mutations on loca 228, 235 and 445 of an area CH2, so that an ADCC (antibody-dependent cell-mediated cytotoxicity) effector function of an antibody segment Fc is lowered. Compared with the similar products, the blood coagulator factor VIII fusion protein has similar or relatively high in-vitro biological activity, relatively low binding force of vWF protein, a relatively long half-life period, a relatively long dosing interval and a relatively low drug-use dose.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a fusion protein of eight coagulation factors and its preparation method and application. Background technique [0002] Hemophilia A is a congenital hemorrhagic disease caused by the deficiency of the eighth factor of coagulation, that is, the function deficiency of the eighth factor of blood coagulation in the body caused by the gene defect associated with the X-chromosome, and the patient shows coagulation function after trauma Obstacles and repeated spontaneous bleeding gradually lead to soft tissue and joint cavity damage and disability. The incidence rate is 15-20 per 100,000 population. [0003] The most effective treatment for hemophilia A is to infuse normal human plasma, plasma-derived concentrated human blood coagulation factor VIII preparations, or gene recombinant-derived blood coagulation factor VIII preparations to treat or prevent bleeding. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/85C12N5/10C12P21/02A61K38/37A61K47/48A61K48/00A61P7/04
Inventor许必雄郭颀然陈汉胜
OwnerSYNDEGEN SHANGHAI BIOTECH