Reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of peste des petits ruminants virus
A technology of Peste des petits ruminants and kits, which is applied in the direction of microorganism-based methods, microorganism measurement/inspection, microorganisms, etc., can solve the problems of not being able to meet the needs of rapid, sensitive, accurate and quantitative detection, and achieve high accuracy, The effect of high specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] 1. Design and preparation of primers:
[0037] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:
[0038] The amplification primer sequences are:
[0039] SEQ ID NO.1: Upstream primer TTAATTGATTGGGCTGATGGTCT,
[0040] SEQ ID NO.2: downstream primer GCTGCCGGCAATGATGTCTC.
[0041] The probe primer sequence is:
[0042] SEQ ID NO. 3: GTTCTTGACATCGGGTATTTCCGGGAC.
[0043] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.
[0044] Positive control: the positive control of the kit of the present invention and its standard curve were constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.
[0045] 2. Prepare the kit:
[0046] This kit consists of the following components:
...
Embodiment 2
[0060] Steps 1 to 2 are the same as in Example 1;
[0061] 3. The method for detecting PPRV with the kit of the present invention:
[0062] (1) The total PCR system is 25 μl. In the kit of the present invention, a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. a total of 3 μl of three primers; f . Add 5.5 μl of RNase-free water to a 0.2 ml amplification tube;
[0063] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from the intestinal tract of sheep to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 s, put the amplification tubes into the amplification instrument, and Amplification under the set program: pre-denaturation at 94°C for 2 min; 94°C for 20 s, annealing temperature at 54°C for 30 s, 72°C for 20 s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.
[0064] 4. Re...
Embodiment 3
[0067] Steps 1 to 2 are the same as in Example 1;
[0068] 3. Use the method for detecting PRV with the kit of the present invention:
[0069] (1) The total PCR system is 25 μl. In the kit of the present invention, a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. a total of 3 μl of three primers; f . Add 5.5 μl of RNase-free water to a 0.2 ml amplification tube;
[0070] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from sheep lymph nodes to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12,000 rpm for 5-30 s, put the amplification tubes into the amplification instrument, and Amplification under the set program: pre-denaturation at 94°C for 2 min; 94°C for 20 s, annealing temperature at 54°C for 30 s, 72°C for 20 s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.
[0071] 4. Result ana...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com