Reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of peste des petits ruminants virus

A technology of Peste des petits ruminants and kits, which is applied in the direction of microorganism-based methods, microorganism measurement/inspection, microorganisms, etc., can solve the problems of not being able to meet the needs of rapid, sensitive, accurate and quantitative detection, and achieve high accuracy, The effect of high specificity and high sensitivity

Active Publication Date: 2015-02-25
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The technical problem to be solved by the present invention is to overcome the existing technology can not adapt to fast, sensitive and accurate and quantitative detection requirements, thereby providing a fast, sensitive and accurate As well as a Taqman Real-time RT-PCR kit for detecting Peste des Petits Ruminants virus quantitatively, the present invention also provides a method for using the kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of peste des petits ruminants virus
  • Reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of peste des petits ruminants virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Design and preparation of primers:

[0037] Refer to GenBank (gene bank) to find ten strains, find the conserved regions on each sequence through sequence comparison, select the conserved regions and design a pair of amplification primers and a probe primer, the sequence is as follows:

[0038] The amplification primer sequences are:

[0039] SEQ ID NO.1: Upstream primer TTAATTGATTGGGCTGATGGTCT,

[0040] SEQ ID NO.2: downstream primer GCTGCCGGCAATGATGTCTC.

[0041] The probe primer sequence is:

[0042] SEQ ID NO. 3: GTTCTTGACATCGGGTATTTCCGGGAC.

[0043] The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.

[0044] Positive control: the positive control of the kit of the present invention and its standard curve were constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0045] 2. Prepare the kit:

[0046] This kit consists of the following components:

...

Embodiment 2

[0060] Steps 1 to 2 are the same as in Example 1;

[0061] 3. The method for detecting PPRV with the kit of the present invention:

[0062] (1) The total PCR system is 25 μl. In the kit of the present invention, a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. a total of 3 μl of three primers; f . Add 5.5 μl of RNase-free water to a 0.2 ml amplification tube;

[0063] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from the intestinal tract of sheep to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12000 rpm for 5-30 s, put the amplification tubes into the amplification instrument, and Amplification under the set program: pre-denaturation at 94°C for 2 min; 94°C for 20 s, annealing temperature at 54°C for 30 s, 72°C for 20 s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.

[0064] 4. Re...

Embodiment 3

[0067] Steps 1 to 2 are the same as in Example 1;

[0068] 3. Use the method for detecting PRV with the kit of the present invention:

[0069] (1) The total PCR system is 25 μl. In the kit of the present invention, a. 2×One Step RT-PCR bufferIII: 12.5 μL; b. Ex Taq HS: 0.5 μL; c. PrimerScript RT Enzyme Mix II: 0.5 μL; d. a total of 3 μl of three primers; f . Add 5.5 μl of RNase-free water to a 0.2 ml amplification tube;

[0070] (2) Add 3 μl of positive control, 3 μl of RNA template extracted from sheep lymph nodes to be tested, and 3 μl of negative control to the above-mentioned amplification tubes, centrifuge at 12,000 rpm for 5-30 s, put the amplification tubes into the amplification instrument, and Amplification under the set program: pre-denaturation at 94°C for 2 min; 94°C for 20 s, annealing temperature at 54°C for 30 s, 72°C for 20 s, 40 cycles. Directly observe the amplification results on the real-time quantitative amplification instrument.

[0071] 4. Result ana...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a reagent kit used for testing Taqman Real-time RT-PCR (reverse transcription-polymerase chain reaction) of the peste des petits ruminants virus. The reagent kit comprises amplification premixed solution, negative control, positive control and a mixture of SEQIDNO.1 to SEQIDN0.2 amplification primers and an SEQIDNO.3 probe primer. The reagent kit has the advantages that variation of each circular amplicon in PCR (polymerase chain reaction) is tested in real time by the aid of variation of fluorescence signals, a starter template is subjected to quantitative analysis through the relation of Ct values and a standard curve, and the test kit used for testing the peste des petits ruminants virus is high in specificity, good in stability and easy to operate; the test kit has higher sensitivity than common PCR and can be used for testing the peste des petits ruminants virus of low and micro-content samples; the test kit is applicable to not only quantitative analysis of research units but also pathogen testing analysis of prevention and control units at all levels, base veterinary stations and large and medium-sized livestock farms and the like, thereby having good application prospect.

Description

[0001] technical field [0002] The invention relates to the technical field of prevention and control of Peste des petits ruminants, specifically a Taqman Real-time RT-PCR (probe method real-time-quantitative polymerase chain reaction) kit for detecting Peste des petits ruminants virus. The invention also includes the How to use the kit. Background technique [0003] Peste des petits ruminants (PPR) is a serious infectious disease caused by Peste des petits ruminants virus (PPRV), which mainly infects small ruminants, especially goats, which are highly susceptible. The virus is a member of the Morbolivirus genus of the Paramyxoviridae family, along with other members of the genus Rinderpest virus, [0004] RPV), canine distemper virus (CDV), seal distemper virus (Porpoise distemper virus, PDV), etc. PPRV mainly invades lymphoid tissue and digestive tract epithelial tissue, and is characterized by sudden fever, secretions from eyes and nose, oral ulcers, respiratory disord...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
CPCC12Q1/6851C12Q1/70C12Q2531/113C12Q2561/101C12Q2561/113
Inventor 刘湘涛吴锦艳田宏陈妍尚佑军王光祥
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap