Check patentability & draft patents in minutes with Patsnap Eureka AI!

Preparation method of UCMSC (umbilical cord mesenchymal stem cell) modified with HGF (hepatocyte growth factor) gene and used for treating liver failure

A gene modification and gene technology, applied in the field of HGF-modified UCMSC preparation, can solve the problems of difficult access, lack of donors, and limited clinical application

Inactive Publication Date: 2015-04-29
SHENZHEN BEIKE BIOTECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the lack of donors and the difficulty of obtaining bone marrow-derived stem cells, its clinical application is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of UCMSC (umbilical cord mesenchymal stem cell) modified with HGF (hepatocyte growth factor) gene and used for treating liver failure
  • Preparation method of UCMSC (umbilical cord mesenchymal stem cell) modified with HGF (hepatocyte growth factor) gene and used for treating liver failure
  • Preparation method of UCMSC (umbilical cord mesenchymal stem cell) modified with HGF (hepatocyte growth factor) gene and used for treating liver failure

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The present invention will be described in further detail below through specific examples. The following examples are only descriptive, not restrictive, and cannot limit the protection scope of the present invention with this.

[0031] gene cloning

[0032] By PCR amplification method, pCR4Topo-HGF is used as the template, and the upstream primer is 756hHGFNhe-F:

[0033] TGCTAGCGCCACCATGTGGGTGACCAAACTCCTGCCAGC (SEQ ID NO: 2), the downstream primer is 757hHGFSalI-R:

[0034] AGTCGACCTATGACTGTGGTACCTTATATGTTA (SEQ ID NO: 3).

[0035] PCR system:

[0036] 3×Taq mix: 3ul

[0037] Primer (1μM): 3ul

[0038] h 2 O: 2ul

[0039] Template: 1 ul

[0040] PCR program:

[0041] 99°C 10m

[0042] 94°C 30s

[0043] 60℃ 30s

[0044] 72℃ 2min

[0045] 40 cycles

[0046] 72°C 10min

[0047] HGF fragments were obtained by PCR amplification, agarose gel electrophoresis was performed, the target fragments were cut off, and the DNA fragments were recovered with a gel recovery...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention discloses a preparation method of a UCMSC (umbilical cord mesenchymal stem cell) modified with an HGF (hepatocyte growth factor) gene. The method comprises steps as follows: A) cloning of the HGF gene; B) preparation of a shuttle plasmid containing an HGF target gene; C) establishment of an HGF-containing replication-deficient adenovirus Ad-HGF; D) preparation of the UCMSC which is modified with the gene and over-expresses HGFs. The adenovirus packaged with the HGF gene is used for infecting the UCMSC, and the UCMSC which is modified with the gene and over-expresses the HGFs can be effectively prepared.

Description

technical field [0001] The invention belongs to the field of bioengineering and relates to a method for preparing UCMSC modified by HGF. Background technique [0002] Liver failure (Liver Failure) is severe liver damage caused by a variety of factors, resulting in serious impairment or decompensation of its synthesis, detoxification, excretion, and biotransformation functions, resulting in coagulation dysfunction, jaundice, hepatic encephalopathy, ascites, etc. A group of clinical syndromes with main manifestations. In recent years, the number of deaths due to liver failure has gradually increased. According to statistics, about 30,000 people die of liver failure in the United States every year, while about 300,000 patients die of this disease in my country every year. Acute liver failure is an acute and severe liver dysfunction, which is characterized by acute onset, critical condition, various symptoms and extensive necrosis of liver cells. At present, the main means o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N5/10A61P1/16
Inventor 唐云霞李陶胡祥刘沐芸
Owner SHENZHEN BEIKE BIOTECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More