Nosema bombycis Met-AP2 gene and application thereof
A technology of microsporidia and silkworm, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of false positives, low sensitivity of primers, etc., and achieve the effects of accurate screening, good detection sensitivity, and convenient use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Cloning of the Met-AP2 gene of Bombyx mori Nos.
[0049] 1. Primer design
[0050] Based on the genome analysis data, the Met-AP2 gene of other species was analyzed, and combined with various microsporidian genomes for homology analysis, a pair of primers MC-F / MC-R was designed through the primer design software Primer5.0, The primer sequences are as follows:
[0051] Upstream primer MC-F (SEQ ID NO.4): ATGAGGCCTATTGTTTTATCAGAAG;
[0052] Downstream primer MC-R (SEQ ID NO. 5): TTAAAAATCATCTCCTTTTGTAAGA.
[0053] 2. PCR amplification
[0054] The DNA and cDNA of Bombyx mori were respectively used as templates, and primers MC-F / MC-R were used for PCR amplification. The reaction system and reaction procedure were as follows:
[0055] The PCR reaction system (total volume 20 μL):
[0056] 2×Taq Master Mix (reaction buffer) 10μL
[0057] 10 μM upstream primer 0.5 μL
[0058]10 μM downstream primer 0.5 μL
[0059] Template DNA 1 μL;
[0060] wxya 2 O to ...
Embodiment 2
[0068] Example 2 Detection primer design and establishment of PCR amplification method
[0069] 1. Primer design
[0070] (1) On the basis of obtaining the Met-AP2 gene of No. silkworm, 14 pairs of primers were designed using Primer premier 5.0 software. The sequences of each set of primers are as follows:
[0071] Upstream primer MC-F (SEQ ID NO.4): ATGAGGCCTATTGTTTTATCAGAAG;
[0072] Downstream primer MC-R (SEQ ID NO. 5): TTAAAAATCATCTCCTTTTGTAAGA.
[0073] Upstream primer 2047-F (SEQ ID NO.6): GGAGAAGGGTGATGGAATAG;
[0074] Downstream primer 2047-R (SEQ ID NO. 7): CGACGGTAGATAACCACATA.
[0075] Upstream primer M6-F (SEQ ID NO.8): CCCCTAAATGAGGCC;
[0076] Downstream primer M6-R (SEQ ID NO.9): CCTATTCCATCACCCT.
[0077] Upstream primer M7-F (SEQ ID NO.10): CCCCTAAATGAGGCC;
[0078] Downstream primer M7-R (SEQ ID NO.11): TGGAAGCACGGTAAA.
[0079] Upstream primer M8-F (SEQ ID NO.12): TTTCTGCTCCCCTAAA;
[0080] Downstream primer M8-R (SEQ ID NO. 13): TTCCATCACCCTTCTC....
Embodiment 3
[0116] Example 3 Primer Specific Detection
[0117] 1. Take No. silkworm, No. mulberry borer, No. mulberry looper, No. litura, No. xylostella, No. rapae, No. tussah, No. zhejiang worm, No. corn borer or No. megasporosa Shandong as templates, using the PCR method of Example 2, the detection specificity of the 7 pairs of primers screened in Example 2 was studied.
[0118] 2. The results showed that only five pairs of primers, MC-F and MC-R, 2047-F and 2047-R, M5-F and M5-R, M6-F and M6-R, M7-F and M7-R, could There are many types of microsporidia detected, and 7, 6, 5, 5 and 4 types of microsporidia can be detected respectively. Specific as attached Figure 3-6 shown.
[0119] Among them, MC-F and MC-R detect the most types of microsporidia, and can simultaneously detect No. There are 7 common main microsporidia in mulberry gardens, including microsporidia, microsporidium rapae and microsporidium tussah, which have the best detection versatility and have a good application...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com