Atrazine degrading bacterium and application thereof
A technology of atrazine and degrading bacteria, applied in the application, bacteria, biological water/sewage treatment and other directions, can solve the problems of plant poisoning, unsatisfactory restoration effect, long retention period, etc., to achieve low cost, high social and ecological Benefit, the effect of reducing pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Isolation of bacterial strain liulou 1
[0030] Strain liulou 1 was directly isolated from SM solid medium, in which atrazine was used as the only nitrogen source and Tween 80 was used as a dispersant. The surfactant improves the availability of the hydrophobic atrazine in the SM medium, and enables selective screening of atrazine-degrading strains from soils from different sources, including industrial soils and agricultural soils, using plates. The omission of the enrichment stage eliminated the enrichment bias and allowed the isolation of atrazine-degrading bacteria dominant in the environment.
[0031] Strain liulou 1 was isolated from the rhizosphere of corn that had been used for a long time with atrazine, and the sampling location was the cornfield of Liulou Village, Binhe Office, Dingtao County, Heze City, Shandong Province.
[0032] The corn roots and the 15×10×10 cm soil around the rhizosphere in the growing period were taken as samples. On the sec...
Embodiment 2
[0033] Example 2 Phylogenetic Identification of Arthrobacter ureagenes liulou 1
[0034] method
[0035] 16S rRNA gene amplification primer pair 63KWf (5'CAKGCCTWACACATGCAAGTC 3') and 1287r (5'GGGCGGWGTGTACAAGGC 3'). 50 μL system for PCR, 5 μL 10×Ex Taq Buffer (Takara Biological Co., Ltd. (Dalian)), 2.0 mM MgCl 2 , 250 μM dNTP, 0.5 μM primer, 0.5U TaKaRa Ex Taq polymerase and 1.25 μL bacterial lysate as template. The amplification system of PCR is: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 2 minutes, 30 cycles; final extension at 72°C for 5 minutes. PCR amplification products were analyzed by electrophoresis with 0.5×TBE buffer. The 1.3kb target fragment was recovered by cutting the gel, and recovered using TaKaRa MiniBEST Agarose DNA Gel Cutting and Recovery Kit 4.0. The recovered fragment was used as a template to be amplified with 63KWf and 1287r primers and sequenced. Sequencing ana...
Embodiment 3
[0040] Example 3 The repeated sequence PCR (Rep-PCR) method classifies and identifies liulou 1 strains
[0041] method
[0042] The liulou 1 strain was identified by repeat sequence PCR (Rep-PCR) based on BOXA1R (5'CTACGGCAAGGCGACGCTGACG 3') and ERIC2 (5'AAGTAAGTGACTGGGGTGAGCG 3') primers. The PCR reaction system is 20 μL, 2 μL 10×Ex Taq Buffer, (Takara Biological Co., Ltd. (Dalian)), 2.0 mM MgCl 2 , 250 μM dNTPs, 0.5 μM primers, 0.5 U TaKaRa Ex Taq polymerase and 0.5 μL template. The Rep-PCR amplification system is: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 1 minute, annealing at 40°C (ERIC-PCR) or 55°C (BOX-PCR) for 1 minute, extension at 68°C for 8 minutes, 4 Cycle: Denaturation at 94°C for 1 minute, annealing at 52°C (ERIC-PCR) or 65°C (BOX-PCR) for 1 minute, extension at 72°C for 2 minutes, 30 cycles; final extension at 72°C for 5 minutes. PCR amplification products were analyzed by electrophoresis with 0.5×TBE buffer, 2% agarose (Genview, China)...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



