Catalytic light mark and preparation method thereof, and method for determination of trace uranium by catalytic light mark
A trace amount of uranium, catalytic lamp technology, applied in the field of chemical analysis, can solve the problems of high use cost, cumbersome operation process, low sensitivity, etc., and achieve the effects of low requirements for instruments and equipment, wide application range and good selectivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0036] Example, Catalytic Lamp and Its Preparation and Determination of Trace Uranium (Uranium Content) with Catalytic Lamp
[0037] Experimental Materials:
[0038] DNase and substrate DNA were synthesized by Takara Company, and the nucleotide sequence of DNase is: 5'- CACGTCCATCCTCT GCAGTCGGGTAGTTAAACCGACCTTCAGAC ATAGTGAGG GG-3' (sequence 1 in the sequence listing), the black underlined base is complementary to the substrate DNA; the nucleotide sequence of the substrate DNA is: 5'-TAMRA- CC T CACTAT RAGGA AGAGATGGACGT G-3' (sequence 2 in the sequence listing), the base underlined in black is complementary to DNase.
[0039] Uranyl nitrate (UO 2 (NO 3 ) 2 ·6H 2 O) is commercially available.
[0040] 2-(N-Morpholine)ethanesulfonic acid (MES), trishydroxymethylaminomethane (Tris), and EDTA were purchased from Sigma.
[0041] Main equipment:
[0042] Fluorescence spectrophotometer: Model F-7000, Hitachi High-Tech Corporation;
[0043] Electronic balance: model F...
PUM
Property | Measurement | Unit |
---|---|---|
wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap