Catalytic light mark and preparation method thereof, and method for determination of trace uranium by catalytic light mark

A trace amount of uranium, catalytic lamp technology, applied in the field of chemical analysis, can solve the problems of high use cost, cumbersome operation process, low sensitivity, etc., and achieve the effects of low requirements for instruments and equipment, wide application range and good selectivity

Inactive Publication Date: 2015-07-15
EAST CHINA UNIV OF TECH
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above methods are either because of expensive instruments and high cost of use (inductively coupled plasma mass spectrometry), or because of cumbersome operation and long process (inductively coupled plasma spectrometry), or because of low sensitivity and poor selectivity (ultraviolet pulsed fluorescence method) and other reasons are still insufficient in practical applications

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Catalytic light mark and preparation method thereof, and method for determination of trace uranium by catalytic light mark
  • Catalytic light mark and preparation method thereof, and method for determination of trace uranium by catalytic light mark
  • Catalytic light mark and preparation method thereof, and method for determination of trace uranium by catalytic light mark

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0036] Example, Catalytic Lamp and Its Preparation and Determination of Trace Uranium (Uranium Content) with Catalytic Lamp

[0037] Experimental Materials:

[0038] DNase and substrate DNA were synthesized by Takara Company, and the nucleotide sequence of DNase is: 5'- CACGTCCATCCTCT GCAGTCGGGTAGTTAAACCGACCTTCAGAC ATAGTGAGG GG-3' (sequence 1 in the sequence listing), the black underlined base is complementary to the substrate DNA; the nucleotide sequence of the substrate DNA is: 5'-TAMRA- CC T CACTAT RAGGA AGAGATGGACGT G-3' (sequence 2 in the sequence listing), the base underlined in black is complementary to DNase.

[0039] Uranyl nitrate (UO 2 (NO 3 ) 2 ·6H 2 O) is commercially available.

[0040] 2-(N-Morpholine)ethanesulfonic acid (MES), trishydroxymethylaminomethane (Tris), and EDTA were purchased from Sigma.

[0041] Main equipment:

[0042] Fluorescence spectrophotometer: Model F-7000, Hitachi High-Tech Corporation;

[0043] Electronic balance: model F...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention discloses a catalytic light mark and a preparation method thereof, and a method for determination of trace uranium by the catalytic light mark. The catalytic light mark is composed of two parts of a DNA enzyme and a substrate DNA, a 3' end of a DNA enzyme sequence comprises four continuous guanine deoxynucleotides (G), the middle of a substrate DNA sequence has an adenine nucleotide (rA), and a 5' end of the substrate DNA is modified by a 4-methyl-6-carboxyl rhodamine (TAMRA) fluorescent dye. The DNA enzyme and the substrate DNA are in mixing hybridization to form the catalytic light mark, the catalytic light mark is added to a reaction system of a to-be-measured sample to undergo a reaction, the fluorescence intensity of uranyl nitrate ions with known concentration and the fluorescence intensity of the sample are determined, and the uranium content in the sample can be obtained through calculation. The method is a fast, accurate, high-sensitivity and high-selectivity method for determination of trace uranium.

Description

technical field [0001] The invention belongs to the fluorescence detection method of trace uranium in the field of chemical analysis, in particular to a catalytic lamp and a method for detecting trace uranium (uranium content) quickly, accurately, with high sensitivity and high selectivity using the catalytic lamp. Background technique [0002] Uranium is a natural radioactive metal element, which has important applications in energy and military fields, and is an important raw material for nuclear energy and nuclear weapon production. Although uranium plays an important role in human production and life, it is also a common source of radioactive pollution. Existing studies have shown that uranium nuclides can enter the human body directly through the respiratory tract, skin, direct irradiation, etc., and can also enter the human body through the biological cycle through the food chain, thereby causing leukemia and other cancers and some kidney and nervous system diseases (s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/44G01N21/64
CPCC12Q1/68C12Q1/44G01N21/64
Inventor肖赛金朱志强欧阳永中张兴磊陈焕文
OwnerEAST CHINA UNIV OF TECH