Tarim red deer antler c-myc gene and application thereof

A technology for Tarim red deer and red deer antler, which is applied to the Tarim red deer antler c-myc gene and its application field, and can solve the problems of large ossification, low yield, and inability to achieve the production capacity of first stubble antler.

Inactive Publication Date: 2015-07-29
TARIM UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Artificially bred deer mainly regenerate after cutting to increase the production of velvet. However, the harvested red deer do not need to be treated with drugs. Although the red deer antler can be regenerated, the yield is very low. Even if the drug is injected, the production capacity of the first stubble velvet cannot be achieved.
Therefore, the growth rate of regenerated antler is slower than that of head stubble antler, the degree of ossification is higher, and the yield is lower.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tarim red deer antler c-myc gene and application thereof
  • Tarim red deer antler c-myc gene and application thereof
  • Tarim red deer antler c-myc gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Full-length cloning of red deer antler c-myc gene cDNA

[0020] 1. Extraction and purification of total RNA from red deer antler: take 3-4-year-old adult red deer antler skin tissue and store it in liquid nitrogen.

[0021] (1) After fully crushing 0.5-1g of tissue in liquid nitrogen, add 3ml of Trizol reagent and shake vigorously to lyse the tissue;

[0022] (2) Transfer the above-mentioned tissue Trizol lysate into an EP tube, and place it at room temperature for 5 minutes;

[0023] (3) In the above EP tube, add 0.2 ml of chloroform after every 1 ml of Trizol, cover the EP tube, shake vigorously in the hand for 15 seconds, and after 3 minutes at room temperature, 12000 g (2-8 °C ) centrifuged for 15 minutes;

[0024] (4) Remove the upper aqueous phase and put it in a new EP tube, add isopropanol according to the amount of 0.5ml isopropanol per 1ml Trizol, let stand at room temperature for 10 minutes, then centrifuge at 12000g (2-8°C) for 10 minutes;

[0...

Embodiment 2

[0078] Embodiment 2: the application of SNP in promoting the growth of antler

[0079] 1. SNP screening: designed ORF primers,

[0080] Forward primer: GCAGCGATGCCCCACAA

[0081] Reverse primer: AATTTAGGCGCAAGAGTTCCG

[0082] 95°C 10m (94°C 30s tm57.430s 72°C 60s)*37, 72°C 7m amplified fragment 1138bp, PCR amplification of 6 Tarim red deer genomes in vitro, gel recovery, cloning, and sending to Shanghai Biological Company for sequencing; The sequencing results were analyzed with DNAman software, and the sequence comparison results showed that two mutations were located in the second exon, G / C and T / C, respectively.

[0083] 2. SNP detection:

[0084] Forward primer: GTCAGCTTCGCCAACAGAAAC

[0085] Reverse primer: GTTCTTCCTCAGAGTCGCTGC

[0086] 95°C, 10min; (94°C, 30s, 56.3, 30s, 72°C, 60s) 37; 72°C for another 7min, the amplified fragment was 751bp, and the single nucleotide polymorphism (SNP) was detected by sequencing, and it was found that: (1) There are three genotype...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Tarim red deer antler c-myc gene and application thereof, and the nucleotide sequence of the c-myc gene is shown in SEDID NO:1. The Tarim red deer antler c-myc gene also includes the application in antler growth promotion. The Tarim red deer antler c-myc gene disclosed by the invention changes the phenomenon that regenerated antlers grow slowly when depending on nature or medication, and realizes the stable and high yield and high quality of antler products. An experiment shows that the SNP genotyping CG of the Tarim red deer antler c-myc gene can ensure that the weight of red deer antlers is 13.441 plus or minus 1.88kg.

Description

technical field [0001] The invention relates to a red antler gene and its application, in particular to a Tarim red antler c-myc gene and its application. Background technique [0002] Red deer, also known as red deer, is one of the larger deer species. According to statistics, there are 22 subspecies of red deer in the world. In my country, there are Tianshan subspecies, Tarim subspecies, Altay subspecies, Northeast subspecies, and Gansu subspecies. 8 subspecies of red deer, namely, Alashan subspecies, Sichuan subspecies and Tibet subspecies, are mainly distributed in Xinjiang, Qinghai, Gansu, Northeast China and Inner Mongolia. The Tarim red deer is an excellent subspecies of the Chinese red deer population. It has unique adaptability to the desert area of ​​the Tarim Basin. It can tolerate extreme heat, drought, wind and sand, and high salinity. It is derived from the Tarim Basin for generations. name. Tarim red deer is a rare special economic animal, known for its high ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/10C12Q1/68
Inventor韩春梅高庆华王姗姗孟浩郑永富马梦婷阚凡凡张勤
OwnerTARIM UNIV