A method for constructing a high-throughput sequencing library
A sequencing library and high-throughput technology, applied in the fields of genetic engineering and molecular biology, can solve problems such as incomplete information, low efficiency of library construction, and large loss of reagents and samples, so as to achieve complete information, improve library construction efficiency, and improve The effect on success rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0035] (1) Sample DNA extraction and quantification;
[0036] (2) DNA fragmentation, purification and fragment selection: Use Covaris ultrasonic breaker to break DNA, make DNA sample 400-700bp, temperature is 20°C, first use Qiagen's MinElute to purify, and then use 2.5% agarose Gel electrophoresis gel recovery, recovery and selection of 450-700bp fragments;
[0037] (3) Agilent's Bioanalyzer DNA 7500 LabChip was used to evaluate the quality of DNA fragments;
[0038] (4) DNA fragment blunt end: fill in the gap at the 5' end and remove the sticky end at the 3' end;
[0039] (5) Adapter-connected phosphate: the 5' end of the adapter is the primer end, with biotin, using T4 polynucleotide kinase to label on the side of the adapter, the blunt 5' end is connected to a phosphate group, and ligated for 7 hours , get joint a,
[0040] 5′GCAAGTCTCGATTGGAGCTCTGCTCCAGTGCATCACT 3′
[0041] 3'GTACATGCACGACTCAGTCCTGATCCGTAGTGAp 5',
[0042] Tagged as GCATCACT and CGTAGTGA;
[0043] (...
Embodiment 2
[0048] (1) Sample DNA extraction and quantification;
[0049] (2) DNA fragmentation, purification and fragment selection: Use Covaris ultrasonic breaker to break DNA, make DNA sample 500-700bp, temperature is 18°C, first use Qiagen's MinElute to purify, and then use 2.5% agarose Gel electrophoresis gel recovery, recovery and selection of 500-700bp fragments;
[0050] (3) Agilent's Bioanalyzer DNA 7500 LabChip was used to evaluate the quality of DNA fragments;
[0051] (4) DNA fragment blunt end: fill in the gap at the 5' end and remove the sticky end at the 3' end;
[0052] (5) Adapter-connected phosphoric acid: the end of the 5' chain of the adapter is the primer end, with biotin, using T4 polynucleotide kinase to label on the side of the adapter, the blunt 5' end is connected to a phosphate group, and ligated for 8.5 hours , the linker after connecting the phosphoric acid is linker b:
[0053] 5'GTCGTACAGCTAGTCCTGAGGATGCAGTTCACTAGT3'
[0054] 3'CCTAGCTGCATACGTCACACGAGTCA...
Embodiment 3
[0061] (1) Sample DNA extraction and quantification;
[0062] (2) DNA fragmentation, purification and fragment selection: Use Covaris ultrasonic fragmentation instrument to fragment DNA, make DNA sample into 400-700bp, the temperature is 16°C, first purify with Qiagen's MinElute, and then use Double SPRIbead method to recover, Recover and select fragments of 450-700bp;
[0063] (3) Agilent's Bioanalyzer DNA 7500 LabChip was used to evaluate the quality of DNA fragments;
[0064] (4) DNA fragment blunt end: fill in the gap at the 5' end and remove the sticky end at the 3' end;
[0065] (5) Adapter-connected phosphoric acid: The end of the 5' chain of the adapter is the primer end, with biotin, using T4 polynucleotide kinase to label on the side of the adapter, the blunt 5' end is connected to a phosphate group, and ligated for 8 hours , get joint a,
[0066] 5′GCAAGTCTCGATTGGAGCTCTGCTCCAGTGCATCACT 3′
[0067] 3'GTACATGCACGACTCAGTCCTGATCCGTAGTGAp 5',
[0068] Tagged as GCAT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com