A method for constructing a high-throughput sequencing library

A sequencing library and high-throughput technology, applied in the fields of genetic engineering and molecular biology, can solve problems such as incomplete information, low efficiency of library construction, and large loss of reagents and samples, so as to achieve complete information, improve library construction efficiency, and improve The effect on success rate

Active Publication Date: 2017-09-05
BEIJING ZHONGKEZIXIN TECH
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The existing technology still has the problems of low library construction efficiency, large loss of reagents and samples, and incomplete information. New methods need to be constructed to solve the problems

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] (1) Sample DNA extraction and quantification;

[0036] (2) DNA fragmentation, purification and fragment selection: Use Covaris ultrasonic breaker to break DNA, make DNA sample 400-700bp, temperature is 20°C, first use Qiagen's MinElute to purify, and then use 2.5% agarose Gel electrophoresis gel recovery, recovery and selection of 450-700bp fragments;

[0037] (3) Agilent's Bioanalyzer DNA 7500 LabChip was used to evaluate the quality of DNA fragments;

[0038] (4) DNA fragment blunt end: fill in the gap at the 5' end and remove the sticky end at the 3' end;

[0039] (5) Adapter-connected phosphate: the 5' end of the adapter is the primer end, with biotin, using T4 polynucleotide kinase to label on the side of the adapter, the blunt 5' end is connected to a phosphate group, and ligated for 7 hours , get joint a,

[0040] 5′GCAAGTCTCGATTGGAGCTCTGCTCCAGTGCATCACT 3′

[0041] 3'GTACATGCACGACTCAGTCCTGATCCGTAGTGAp 5',

[0042] Tagged as GCATCACT and CGTAGTGA;

[0043] (...

Embodiment 2

[0048] (1) Sample DNA extraction and quantification;

[0049] (2) DNA fragmentation, purification and fragment selection: Use Covaris ultrasonic breaker to break DNA, make DNA sample 500-700bp, temperature is 18°C, first use Qiagen's MinElute to purify, and then use 2.5% agarose Gel electrophoresis gel recovery, recovery and selection of 500-700bp fragments;

[0050] (3) Agilent's Bioanalyzer DNA 7500 LabChip was used to evaluate the quality of DNA fragments;

[0051] (4) DNA fragment blunt end: fill in the gap at the 5' end and remove the sticky end at the 3' end;

[0052] (5) Adapter-connected phosphoric acid: the end of the 5' chain of the adapter is the primer end, with biotin, using T4 polynucleotide kinase to label on the side of the adapter, the blunt 5' end is connected to a phosphate group, and ligated for 8.5 hours , the linker after connecting the phosphoric acid is linker b:

[0053] 5'GTCGTACAGCTAGTCCTGAGGATGCAGTTCACTAGT3'

[0054] 3'CCTAGCTGCATACGTCACACGAGTCA...

Embodiment 3

[0061] (1) Sample DNA extraction and quantification;

[0062] (2) DNA fragmentation, purification and fragment selection: Use Covaris ultrasonic fragmentation instrument to fragment DNA, make DNA sample into 400-700bp, the temperature is 16°C, first purify with Qiagen's MinElute, and then use Double SPRIbead method to recover, Recover and select fragments of 450-700bp;

[0063] (3) Agilent's Bioanalyzer DNA 7500 LabChip was used to evaluate the quality of DNA fragments;

[0064] (4) DNA fragment blunt end: fill in the gap at the 5' end and remove the sticky end at the 3' end;

[0065] (5) Adapter-connected phosphoric acid: The end of the 5' chain of the adapter is the primer end, with biotin, using T4 polynucleotide kinase to label on the side of the adapter, the blunt 5' end is connected to a phosphate group, and ligated for 8 hours , get joint a,

[0066] 5′GCAAGTCTCGATTGGAGCTCTGCTCCAGTGCATCACT 3′

[0067] 3'GTACATGCACGACTCAGTCCTGATCCGTAGTGAp 5',

[0068] Tagged as GCAT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of genetic engineering and molecular biology, and in particular relates to a method for constructing a high-throughput sequencing library. The steps include (1) DNA fragmentation; (2) purification; (3) linker connection; (4) amplification; (5) small fragment removal; (6) library fixation and other steps. The joint connection efficiency of the present invention is high, and by using the method of the present invention, the sequencing plate can be used simply and efficiently, the loss of samples and reagents is reduced, and a high-throughput sequencing library can be constructed.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and molecular biology, and in particular relates to a method for constructing a high-throughput sequencing library. Background technique [0002] High-throughput sequencing technology (High-throughputsequencing), also known as "next generation" sequencing technology, is characterized by the ability to sequence hundreds of thousands to millions of DNA molecules in parallel at a time and the general read length is relatively short. According to the development history, influence, sequencing principle and technology, there are mainly the following types: massively parallel signature sequencing, polymerase cloning, 454 pyrosequencing, Illumina sequencing, ABISOLiD sequencing, ion semiconductor sequencing, DNA nanosphere sequencing, etc. . High-throughput sequencing technology is a revolutionary change to traditional sequencing. The sequence determination of hundreds of thousands to millions of DNA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C40B50/06C40B40/06C12N15/10C12Q1/68
Inventor高静蔡亦梅徐潇吴超张睿王者馥王绪敏殷金龙任鲁风
OwnerBEIJING ZHONGKEZIXIN TECH