Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Acinetobacter baumannii subunit vaccine antigen protein, and applications thereof

A technology of Acinetobacter baumannii and subunit vaccine, which is applied in the fields of molecular biology and immunology, and can solve the problems such as mixing of irrelevant proteins and impurities of active ingredients, complex Baumannian drug resistance mechanism, and difficulty in improving yield.

Inactive Publication Date: 2015-12-02
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main reasons why Acinetobacter baumannii can cause serious clinical harm are: (1) Baumannii is widely distributed in the hospital environment and can survive for a long time. It mainly exists in human skin, respiratory tract, digestive tract and genitourinary tract. Ultraviolet rays and chemical disinfectants have strong resistance, and conventional disinfectants can only inhibit its growth but not kill it
(2) Most importantly, Bowman's drug resistance mechanism is complex and drug resistance is serious
[0006] It is worth noting that Acinetobacter baumannii OMPs or OMVs are composed of many proteins, and the separation and purification of these proteins is a complicated process, and the yield is difficult to improve, and the active ingredients are mixed with a large number of irrelevant proteins and impurities
Although immunization with OMPs or OMVs is safer than whole-bacteria immunization, it contains many outer membrane and cell wall components of the bacteria, including LPS, which still produces significant toxic and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acinetobacter baumannii subunit vaccine antigen protein, and applications thereof
  • Acinetobacter baumannii subunit vaccine antigen protein, and applications thereof
  • Acinetobacter baumannii subunit vaccine antigen protein, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of the prokaryotic expression plasmid for the outer membrane protein OmpW of Acinetobacter baumannii

[0032] The Acinetobacter baumannii strain ATCC17978 was cultured overnight in LB medium until the bacteria grew to the logarithmic phase (OD 600 =0.4-0.6), the bacterial solution was taken for PCR amplification, and the PCR amplification primer was OmpW-F (5' GGATCC ATGGGGGTGTCTTCATTTACTT3') and OmpW-R (5' GAATTCTTAGAATTTATAGCTATAGCCT3'); the specific PCR system is: bacteria solution: 2 μL; OmpW-F: 2 μL; OmpW-R: 2 μL; dNTP: 2 μL; Taq enzyme: 0.25 μL; 10×Taq enzyme buffer: 2.5 μL; water: 14.25 μL. The PCR program was: ①pre-denaturation at 94°C for 5 minutes; ②denaturation at 94°C for 30 seconds; annealing at 56°C for 30 seconds; extension at 72°C for 1 minute, 35 cycles; ③final extension at 72°C for 10 minutes. The PCR product was gel-recovered (Beijing Tiangen Biology), and the recovered product was connected to the pMD19T-simple vector (Tak...

Embodiment 2

[0033] Embodiment 2: Induced expression of Acinetobacter baumannii OmpW recombinant protein

[0034] Transform the recombinant plasmid into BL21(DE3) competent cells, and pick a single clone to induce expression. The specific method is to inoculate the positive clone into LB medium that has been added with ampicillin (100 mg / mL), and culture it for 16 hours. Transfer the bacterial liquid into the new LB medium with ampicillin at a ratio of 1:5. When the strain grows to the logarithmic phase, add IPTG (1mmol / L) to induce expression, and control the induction expression temperature to 30-37°C , induced expression for 6 hours ( figure 2 ).

Embodiment 3

[0035] Example 3: Preparation and purification of OmpW subunit vaccine antigen

[0036] Centrifuge the sample after overnight induction at 12,000 g at room temperature for 10 minutes to collect the bacteria, wash the bacteria twice with PBS, and then ultrasonically disrupt the cells at 10% maximum power, work for 5 seconds, stop for 5 seconds, and last for 10 minutes. The crushed sample was centrifuged at 12000g for 10 minutes, and the inclusion body precipitate was collected. The inclusion body was washed 3 times with Washbuffer (20mMtris-Hcl, pH8.8, 1M urea) and then added to Solutionbuffer (20mMtris-Hcl, pH8.8, 8M urea). Dissolved, the dissolved inclusion bodies were dialyzed with Bindingbuffer (20mMtris-Hcl, pH8.8) at 4°C overnight for refolding, and the dialysate was purified with an anion-exchange chromatography column HiTrapQFF (GE Healthcare), and filtered through Elutionbuffer (20mMtris-Hcl, pH8 .8, 2M Nacl) after gradient elution, the purified products of different c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biology and immunology, and more specifically provides an acinetobacter baumannii subunit vaccine antigen protein and applications thereof. The gene nucleic acid sequence of acinetobacter baumannii outer membrane protein OmpW is represented by SEQ IDNO:1, an obtained encoded protein is the acinetobacter baumannii subunit vaccine antigen protein, and amino acid sequence of the acinetobacter baumannii subunit vaccine antigen protein is represented by SEQ IDNO:2. A preparation method comprises following steps: prokaryotic expression plasmid OmpW-pThioHisA of OmpW vaccine atigen is constructed, and is transformed into BL21(DE3); after inducible expression, recycling and purification of OmpW recombinant protein are carried out, and the OmpW recombinant protein is mixed with aluminum hydroxide adjuvant so as to obtain a mixed solution which is capable of stimulating bodies to generate specific antibodies, wherein the specific antibodies possesses high efficiency immunoprotection effects on acinetobacter baumannii infection, and can be used for preventing acinetobacter baumannii infection.

Description

technical field [0001] The invention relates to the fields of molecular biology and immunology, in particular to an immunoprotective subunit vaccine and its application. Background technique [0002] With the rapid development of medical technology, especially the widespread use of antibiotics, the level of treatment of infectious diseases has been continuously improved, but the phenomenon of abuse of antibiotics has increased. Under the strong pressure of antibiotics, a large number of After repeated contact with drugs, the sensitivity of these drug-resistant bacteria to drugs decreases or even disappears, resulting in reduced or even ineffective efficacy of drugs against drug-resistant bacteria. Acinetobacter baumannii (Acinetobacter baumannii, Ab) has become the most common clinical nosocomial infection pathogen. [0003] Bowman's infection can cause sepsis, soft tissue or wound infection, catheter-related infection, urinary tract infection, bacteremia, secondary men...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/22C12N15/31A61K39/02A61P31/04
CPCA61K39/00C07K14/22
Inventor 马雁冰黄惟巍姚宇峰王世杰杨旭夏烨孙文佳刘存宝白红妹
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com