Unlock instant, AI-driven research and patent intelligence for your innovation.
Recombination and drug screening application of aqp5 promoter luciferase reporter gene
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A promoter sequence, drug technology, applied in the field of bioengineering
Active Publication Date: 2019-04-09
NORTHEAST NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
So far, there is no effective drug for the treatment of this disease, so the development of effective drugs for the treatment of Sjögren's syndrome has important practical significance
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0041] Embodiment one: the construction of pGL2-AQP5p recombinant plasmid [ figure 2 】
[0042] 1. Acquisition of target fragments
[0043] The AQP5 promoter was searched through the NCBI database, and primers for the full length of the AQP5 promoter were designed using primer premier 5.0 primer design software. Using the human genome as a template, the upstream primers are
[0044] 5' GGTACC AAGACAGCAAAAGGCAGGAAGG (containing KpnI restriction site), the downstream primer is
[0045] 5' CTCGAG GCATGATGCGCCCAGGTT (including HindIIIrestriction site), PCR was carried out, and the target fragment of AQP5 promoter was successfully amplified, with a length of 964bp【 image 3 ], the AQP5 promoter DNA fragment was recovered using the AxyPrep PCR cleaning kit.
[0046] 2. Construction of pGEM-T-AQP5p recombinant plasmid
[0047] Connect the AQP5 promoter fragment to the pGEM-T Easy vector, such as【 Figure 4] Shown. The ligationsystem was 5ul of SolutionI ligase, 0.5ul of...
[0054] First with 2×10 5 Density per well Spread HEK293T cells in a 48-well plate to make the cells reach 70% confluency, 37°C CO 2 Overnight in the incubator; dissolve 10 μL of liposomes, recombinant plasmid (100 ng per well), and pREP7-Rluc internal reference plasmid (25 ng per well) in 500 μL opttimem, shake and mix, combine into one tube, mix well, and let stand at room temperature 30min. Add 20 μL per well into a 48-well plate, 37°C CO 2 Overnight in the incubator; 48-well plates were divided into PBS, ginsenoside Rb1 (concentrations were 1 × 10 - 12 g / ml, 1×10 -11 g / ml, 1×10 -10 g / ml, 1×10 -9 g / ml, 1×10 -8 g / ml) in six groups, each with 3 parallel wells, at 37°C CO 2...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
AQP5 (human aquaporin 5) plays an important role in a secretion process of saliva and is closely related to occurrence of SS (Sjogren syndrome). According to the invention, a recombinant expression carrier containing an AQP5 promoter sequence of high transcriptional activity and luciferasereporter gene is constructed by using genetic engineering technology, an AQP5 promoterdrug-screening cell model is constructed by using the recombinant expression carrier, ginsenoside Rb1 drugs obtained by screening are capable of promoting transcription of an AQP5 promoter and increasing expression of AQP5 proteins in HSG cells; then, animal experiments show that the Rb1 is capable of significantly treating SS and discover that the Rb1 is capable of promoting secretion of salivary glands of mice with SS, relieving submandibular gland inflammation and increasing protein expression of submandibular gland AQP5 to improve oral thirst. In conclusion, the Rb1 drug are screened using an AQP5 luciferasereporter gene promoter, the Rb1 is proved to be effective in increasing AQP5 genes, the use of animal models shows that the Rb1 is capable of significantly treating SS, and basis is provided for the clinical application of the drugs in treating SS.
Description
technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to the recombination of a luciferasereporter gene of a human aquaporin 5 (AQP5) promoter, the construction of a cell model of the AQP5 promoter, and the use of the same to screen possible drug monomers. Background technique [0002] Sjögren's syndrome (SS) is an autoimmune disease mainly invading salivary glands, lacrimal glands and other exocrine glands. Patients often manifest as chapped lips, oral mucosal ulcers, rampant caries, fungal and viral infections accompanied by burning pain, foreign bodysensation, etc. The above clinical symptoms are all due to the decrease in the secretion of saliva in the patient's mouth. With the change of people's lifestyle, its incidence rate is getting higher and higher. The incidence rate in adults is 0.5%-3.0%, and it occurs more frequently in middle-aged and elderly women, with a male to female ratio of 1:9. So far, ther...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.