Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombination and drug screening application of aqp5 promoter luciferase reporter gene

A promoter sequence, drug technology, applied in the field of bioengineering

Active Publication Date: 2019-04-09
NORTHEAST NORMAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no effective drug for the treatment of this disease, so the development of effective drugs for the treatment of Sjögren's syndrome has important practical significance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination and drug screening application of aqp5 promoter luciferase reporter gene
  • Recombination and drug screening application of aqp5 promoter luciferase reporter gene
  • Recombination and drug screening application of aqp5 promoter luciferase reporter gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment one: the construction of pGL2-AQP5p recombinant plasmid [ figure 2 】

[0042] 1. Acquisition of target fragments

[0043] The AQP5 promoter was searched through the NCBI database, and primers for the full length of the AQP5 promoter were designed using primer premier 5.0 primer design software. Using the human genome as a template, the upstream primers are

[0044] 5' GGTACC AAGACAGCAAAAGGCAGGAAGG (containing KpnI restriction site), the downstream primer is

[0045] 5' CTCGAG GCATGATGCGCCCAGGTT (including HindIII restriction site), PCR was carried out, and the target fragment of AQP5 promoter was successfully amplified, with a length of 964bp【 image 3 ], the AQP5 promoter DNA fragment was recovered using the AxyPrep PCR cleaning kit.

[0046] 2. Construction of pGEM-T-AQP5p recombinant plasmid

[0047] Connect the AQP5 promoter fragment to the pGEM-T Easy vector, such as【 Figure 4] Shown. The ligation system was 5ul of SolutionI ligase, 0.5ul of...

Embodiment 2

[0050] Example two: drug screening

[0051] 1. Culture of Cell Lines

[0052] HEK293T cells were cultured in DMEM, supplemented with 10% fetal bovine serum, 100U / mL penicillin and 100ug / mL streptomycin. Cells at 37°C, 5% CO 2 cultured in an incubator.

[0053] 2. Application of drug screening

[0054] First with 2×10 5 Density per well Spread HEK293T cells in a 48-well plate to make the cells reach 70% confluency, 37°C CO 2 Overnight in the incubator; dissolve 10 μL of liposomes, recombinant plasmid (100 ng per well), and pREP7-Rluc internal reference plasmid (25 ng per well) in 500 μL opttimem, shake and mix, combine into one tube, mix well, and let stand at room temperature 30min. Add 20 μL per well into a 48-well plate, 37°C CO 2 Overnight in the incubator; 48-well plates were divided into PBS, ginsenoside Rb1 (concentrations were 1 × 10 - 12 g / ml, 1×10 -11 g / ml, 1×10 -10 g / ml, 1×10 -9 g / ml, 1×10 -8 g / ml) in six groups, each with 3 parallel wells, at 37°C CO 2...

Embodiment 3

[0055] Example 3: Drug efficacy verification

[0056] 1. Drug efficacy verification at the cell level

[0057] 1.1 Culture of cell lines

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

AQP5 (human aquaporin 5) plays an important role in a secretion process of saliva and is closely related to occurrence of SS (Sjogren syndrome). According to the invention, a recombinant expression carrier containing an AQP5 promoter sequence of high transcriptional activity and luciferase reporter gene is constructed by using genetic engineering technology, an AQP5 promoter drug-screening cell model is constructed by using the recombinant expression carrier, ginsenoside Rb1 drugs obtained by screening are capable of promoting transcription of an AQP5 promoter and increasing expression of AQP5 proteins in HSG cells; then, animal experiments show that the Rb1 is capable of significantly treating SS and discover that the Rb1 is capable of promoting secretion of salivary glands of mice with SS, relieving submandibular gland inflammation and increasing protein expression of submandibular gland AQP5 to improve oral thirst. In conclusion, the Rb1 drug are screened using an AQP5 luciferase reporter gene promoter, the Rb1 is proved to be effective in increasing AQP5 genes, the use of animal models shows that the Rb1 is capable of significantly treating SS, and basis is provided for the clinical application of the drugs in treating SS.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to the recombination of a luciferase reporter gene of a human aquaporin 5 (AQP5) promoter, the construction of a cell model of the AQP5 promoter, and the use of the same to screen possible drug monomers. Background technique [0002] Sjögren's syndrome (SS) is an autoimmune disease mainly invading salivary glands, lacrimal glands and other exocrine glands. Patients often manifest as chapped lips, oral mucosal ulcers, rampant caries, fungal and viral infections accompanied by burning pain, foreign body sensation, etc. The above clinical symptoms are all due to the decrease in the secretion of saliva in the patient's mouth. With the change of people's lifestyle, its incidence rate is getting higher and higher. The incidence rate in adults is 0.5%-3.0%, and it occurs more frequently in middle-aged and elderly women, with a male to female ratio of 1:9. So far, ther...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N5/10C12Q1/66C12Q1/02A61K31/704A61P37/00
Inventor 李晓萌李江杨柳包瑞贺玺魏溦
Owner NORTHEAST NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com