Mortierella alpine strain overexpressing 3-phosphoglycerol dehydrogenase gene(G3PD1), and construction method and application thereof
A kind of technology of glycerol phosphate dehydrogenase and Mortierella alpina, which is applied in the field of bioengineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Construction of the recombinant Mortierella alpina strain overexpressing the 3-phosphate glycerol dehydrogenase gene
[0031] 1. Cloning of Mortierella alpina G3PD1
[0032] According to the sequence information of Mortierella alpina (M.alpina) ATCC#32222G3PD1 gene (GeneBank KT344118), primers P1 and P2 were designed. P1 / P2, KOD high-fidelity polymerase, amplify the G3PD1 gene by PCR to obtain the target fragment.
[0033] The PCR program is: 94°C for 3min, 94°C for 30s, 58°C for 30s, 68°C for 1.5min, 30 cycles, 68°C for 5min; get the PCR product, then purify the PCR product, and use 1.2% agarose gel to purify the product Electrophoretic verification.
[0034] P1 (sense): CGG GGTACC CCATGTCTGAAAAAGTAGCACTAATCG
[0035] P2 (antisense): TCCC CCCGGG TTAGATATCCTCGACAATCCTGATG
[0036] 2. Construction of binary expression vector
[0037] 1. Enzyme digestion reaction
[0038] Under the condition of 37°C, the PCR purified product of step (1) and the vector ...
Embodiment 2
[0082] Example 2 Mortierella alpina fatty acid extraction and detection
[0083] (1) The Mortierella alpina prototrophic strain and the engineering strain MA-G3PD1-1 (that is, the Mortierella alpina GPD-1 of the present invention), MA-G3PD1, obtained by screening the Mortierella alpina overexpressing the G3PD1 gene obtained in Example 1 -2, MA-G3PD1-3, MA-G3PD1-4 and MA-G3PD1-5 were inoculated in broth medium, cultured on a shaker at 28°C and 200r / min for 7 days;
[0084] ⑵Collect the bacteria, vacuum freeze-dry to constant weight, weigh the weight of the bacteria, and calculate the biomass;
[0085] (3) Grind the bacteria into powder, weigh 50 mg, and add 2 mL of 4 mol / L hydrochloric acid;
[0086] (4) Water bath at 80°C for 1 hour, and place at -80°C for 15 minutes. repeat. 80℃ water bath for 1h;
[0087] (5) Cool to room temperature, add 1mL methanol, and mix well;
[0088] ⑹ Add 1 mL of chloroform and shake for 10 min. Centrifuge at 6000g for 3min. collect chlorofor...
Embodiment 3
[0096] RT-qPCR detection of G3PD1 transcription level in the positive transformant of embodiment 3
[0097] Primers were designed according to the G3PD1 sequence and the internal reference 18SrDNA sequence:
[0098] P5 (sense): TACGCCAACCTTCAGAGTCAA
[0099] P6 (antisense): TGAGACCATCAACCAATCCACC
[0100] P7 (sense): CGTACTACCGATTGAATGGCTTAG
[0101] P8 (antisense): CCTACGGAAACCTTGTTACGACT
[0102] Mortierella alpine total RNA extraction:
[0103] 1. Take out an appropriate amount of bacteria frozen in liquid nitrogen, add liquid nitrogen to a pre-cooled sterile enzyme-free mortar and grind thoroughly;
[0104] 2. Add 1mL TRIzol (Invitrogen, Carlsbad, CA, USA) to continue grinding to powder, and place at room temperature until dissolved;
[0105] 3. Use an enzyme-free pipette tip to pipette 1 mL of the liquid in the above steps into an enzyme-free centrifuge tube, add 200 μL of chloroform and mix well;
[0106] 4. Centrifuge at 12000rpm, 4°C for 15min and aspirate the su...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap