Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

TCS fusion protein with cell-penetrating peptide, plasmid, preparation method and application

A fusion protein and membrane-penetrating peptide technology, applied in the field of genetic engineering, can solve the problems of mutual influence of functions and low expression, and achieve the effects of reducing dosage, improving drug efficacy and high safety.

Inactive Publication Date: 2016-02-10
EAST CHINA UNIV OF SCI & TECH
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] When genetic engineering technology recombines and expresses active protein molecules, it needs to be considered that the two functional domains of the fusion protein are directly connected, which may cause their functional interaction, and also bring some other problems, such as low expression and Expressed in the form of inclusion bodies, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • TCS fusion protein with cell-penetrating peptide, plasmid, preparation method and application
  • TCS fusion protein with cell-penetrating peptide, plasmid, preparation method and application
  • TCS fusion protein with cell-penetrating peptide, plasmid, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] A preparation method of TCS fusion protein with penetrating peptide HBD includes the following steps:

[0086] The preparation method of TCS fusion protein with penetrating peptide HBD includes the following steps:

[0087] (1) The construction of the TCS-connecting peptide-HBD recombinant plasmid includes the following steps:

[0088] (11) Extract the genomic DNA of Trichosanthes from the leaves by the CTAB method, using the upstream primer with the sequence shown in SEQ ID NO. 7 and the downstream primer with the sequence shown in SEQ ID NO. 8 as reaction primers, and the extracted genomic DNA as a template, The nucleotide sequence of the TCS gene is shown in SEQ ID NO. 9, and the PCR reaction obtains the gene encoding the TCS protein, that is, the target gene;

[0089] (12) Purify the PCR product with a gene purification kit, double-enzyme the target gene and HBD expression plasmid with NdeI- / BamHI, connect with T4 ligase to obtain the TCS-connecting peptide-HBD recombinant ...

Embodiment 2

[0104] Two human-derived penetrating peptides ARF and HBD were selected to construct pET28a-TCS-ARF, pET28a-TCS-HBD and pET28b-TCS-HBD, respectively, and expressed by fusion with TCS. The structure is as follows figure 1 Shown.

[0105] According to the existing pET28a-HBD and pET28b-HBD plasmids, the NdeI and BamHI restriction sites were introduced at both ends of the existing TCS gene by PCR. The upstream and downstream primers are: F:TT CATATG GATGTTAGCTTCCGTTTATCAGGTG (underlined is NdeI restriction site), R:TT GGATCC TGCCATATTGTTTCTATTCAGCAGC (underlined is the BamHI restriction site). The PCR program is as follows:

[0106]

[0107] The PCR products were separated and identified by 1% agarose gel electrophoresis. The gel containing the target gene fragment is cut out, the PCR fragment is recovered with the recovery kit, and then ligated to the pMD19-Tsimple vector. After transformation, a single clone is picked, the plasmid is extracted and sequenced.

[0108] After seque...

Embodiment 3

[0114] Expression and purification of TCS-ARF fusion protein

[0115] The successfully constructed pET28a-TCS-ARF expression plasmid was transformed into an E. coli expression strain, and the bacteria were picked and cultured, and the expression was induced with IPTG at 15°C for 12 hours. Broken after collecting the bacteria. The fusion protein TCS-ARF was expressed and purified, and the samples were retained and electrophoresed during the whole process. The results are as follows Figure 5 Shown. From Figure 5 , Lane2 shows that the target protein is expressed after induction. Lane3 is the supernatant protein, in which there is no target protein, lane4 is the inclusion body, there is a band at the size of the target protein. From the results, it can be judged that TCS-ARF is expressed in the form of inclusion bodies. In order to ensure protein activity, the research group chose to purify the soluble form of the fusion protein, so the TCS recombinant protein fused with HBD wa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a TCS fusion protein with cell-penetrating peptide, a plasmid, a preparation method and an application. The fusion protein comprises TCS and the cell-penetrating peptide, wherein the cell-penetrating peptide is human original cell-penetrating peptide and is selected from ARF, HBD or TAT; the fusion protein also contains a linker peptide; and the linker peptide has the length of two amino acids to 20 amino acids, preferably flexible linker peptide. Meanwhile, the TCS fusion protein with the cell-penetrating peptide can be applied to preparation of anti-tumor medicines. Compared with the prior art, the cell-penetrating peptide is introduced into recombinant trichosanthin; the capability of TCS entering the cells over the cell membrane is effectively promoted by introducing the cell-penetrating peptide; and the anti-tumor activity of the TCS is enhanced.

Description

Technical field [0001] The invention relates to the application of trichosanthin, in particular to a TCS fusion protein with penetrating peptide, a plasmid, and a preparation method and application, belonging to the technical field of genetic engineering. Background technique [0002] Trichosanthin (TCS) is the main active ingredient of traditional Chinese medicine Trichosanthes. It belongs to type I ribosome inactivating protein. Trichosanthin was originally used for abortion and miscarriage of pregnant women. In addition, trichosanthin also has anti-tumor activity. At present, the effects of trichosanthin (TCS) on choriocarcinoma, cervical cancer, leukemia lymphoma, and other tumor cells have been deeply studied. Studies have reported that TCS can recognize LRP1 receptors on the cell membrane surface but has a low transmembrane efficiency. TCS itself is highly allergic. It is obviously not feasible to add large doses of TCS during medicinal use, and it is even dangerous. [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K1/22C12N15/70A61K38/16A61K47/42A61P35/00
Inventor 赵健陆叶舟曹雪玮李鹏飞林冰李堰忠罗璠郭超
Owner EAST CHINA UNIV OF SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com