Method for measuring ABCC2 gene polymorphism
A gene polymorphism and gene technology, applied in the field of determination of human ABCC2 gene polymorphism, can solve the problems of being unable to process a large number of samples at the same time, not suitable for a large number of sample detection, up to several hundred dollars, etc., to achieve fast detection speed and low cost , the effect of low labor cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1: Detection of ABCC2c.1249G>A (rs2273697) Gene Polymorphism Using High Resolution Melting Curve Analysis Technology
[0048] 1. Design primers:
[0049] Retrieve the sequence information of the human ABCC2c.1249G>A (rs2273697) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains the target sequence of the gene of interest A sequence consisting of 18-27 bp continuous nucleotides, the length of the PCR product is 80-150bp.
[0050] The sequence of the ABCC2c.1249G>A (rs2273697) gene:
[0051] rs2273697-F:TCAATCCTTATCTTTAGGCAT
[0052] rs2273697-R: ACAGTATCGCATTAATTGGG
[0053] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;
[0054] The test uses TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to supplement the P...
Embodiment 2
[0062] Example 2: Detection of ABCC23972C>T (rs3740066) gene polymorphism using high-resolution melting curve analysis technology
[0063] 1. Design primers:
[0064] Retrieve the sequence information of human ABCC23972C>T (rs3740066) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains 18- in the target sequence of the gene of interest A sequence composed of 27 bp continuous nucleotides, the length of the PCR product is 80-150bp;
[0065] The sequence of the ABCC23972C>T(rs3740066) gene is:
[0066] rs3740066-F: CAAATGATGAAGGCTTAGGG
[0067] rs3740066-R:CTGGGTGACTGATAAGAGGC
[0068] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;
[0069] Choose TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to make up the PCR reaction syste...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com