Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for measuring ABCC2 gene polymorphism

A gene polymorphism and gene technology, applied in the field of determination of human ABCC2 gene polymorphism, can solve the problems of being unable to process a large number of samples at the same time, not suitable for a large number of sample detection, up to several hundred dollars, etc., to achieve fast detection speed and low cost , the effect of low labor cost

Inactive Publication Date: 2016-02-10
AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Taqman is a highly specific quantitative PCR technology, which has the advantages of fewer steps, less pollution, and is convenient for typing large samples; however, it has certain restrictions on primer design, and has certain requirements for sequences near SNPs, which are subject to mutation bases. Site and type limitations; the DNA direct sequencing method is the gold standard for mutation detection, but it is time-consuming, laborious, expensive and other defects, so it is not suitable for detection of a large number of samples
In addition to the above two commonly used methods, some gene products have appeared on the market. Roche’s NimbleGenAccuSNP genotyping chip, which uses chip technology to quickly type mutations at known sites, is one of the hot applications of gene chips at present. The gene chip is fast, accurate, and simple, and the experimental report is qualitative. Its disadvantage is that it is expensive, up to several hundred dollars, and it cannot process a large number of samples at the same time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for measuring ABCC2 gene polymorphism
  • Method for measuring ABCC2 gene polymorphism
  • Method for measuring ABCC2 gene polymorphism

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Detection of ABCC2c.1249G>A (rs2273697) Gene Polymorphism Using High Resolution Melting Curve Analysis Technology

[0048] 1. Design primers:

[0049] Retrieve the sequence information of the human ABCC2c.1249G>A (rs2273697) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains the target sequence of the gene of interest A sequence consisting of 18-27 bp continuous nucleotides, the length of the PCR product is 80-150bp.

[0050] The sequence of the ABCC2c.1249G>A (rs2273697) gene:

[0051] rs2273697-F:TCAATCCTTATCTTTAGGCAT

[0052] rs2273697-R: ACAGTATCGCATTAATTGGG

[0053] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;

[0054] The test uses TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to supplement the P...

Embodiment 2

[0062] Example 2: Detection of ABCC23972C>T (rs3740066) gene polymorphism using high-resolution melting curve analysis technology

[0063] 1. Design primers:

[0064] Retrieve the sequence information of human ABCC23972C>T (rs3740066) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains 18- in the target sequence of the gene of interest A sequence composed of 27 bp continuous nucleotides, the length of the PCR product is 80-150bp;

[0065] The sequence of the ABCC23972C>T(rs3740066) gene is:

[0066] rs3740066-F: CAAATGATGAAGGCTTAGGG

[0067] rs3740066-R:CTGGGTGACTGATAAGAGGC

[0068] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;

[0069] Choose TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to make up the PCR reaction syste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of molecular biological techniques and medical examination, and relates to a device for detecting drug transporter ABCC2 gene polymorphism, in particular to a method for detecting ABCC2 c. 1249 G>A and ABCC 2 3972>T gene polymorphism. After DNA of a sample is extracted, conventional PCR (polymerase chain reaction) amplification (containing fluorescent dye) is carried out, and a melting curve with high resolution ratio is used for analyzing genetic typing of the sample. The method is easy and convenient to operate, a sequence specificity probe is not required, the method is not limited by basic sites, meanwhile, cross contamination is avoided by closed tube operation, and the method has the features of high efficiency, quickness, sensitivity, low cost and high flux, is suitable for clinical conventional gene detection, and further provides a technical support for clinical individual rational drug use.

Description

technical field [0001] The invention belongs to the fields of molecular biology technology and medical examination, and relates to a detection method for the polymorphism of the drug transporter ABCC2 gene, in particular to a high-resolution melting curve analysis method for determining the polymorphism of the human ABCC2 gene, and in particular to a method for detecting the polymorphism of the human ABCC2 gene. A method for detecting the gene polymorphisms of ABCC2c.1249G>A and ABCC23972C>T by the resolution melting curve analysis technique. Background technique [0002] The prior art discloses that heredity is one of the important factors leading to individual differences in drug response. Therefore, using genetic testing to obtain genetic information of patients is of great significance for guiding individualized drug use, improving clinical efficacy and ensuring drug safety. In recent years, the number of drug-related genetic testing products approved by the FDA in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 马春来焦正李中东钟明康
Owner AFFILIATED HUSN HOSPITAL OF FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products