Method for measuring ABCC2 gene polymorphism
A gene polymorphism and gene technology, applied in the field of determination of human ABCC2 gene polymorphism, can solve the problems of being unable to process a large number of samples at the same time, not suitable for a large number of sample detection, up to several hundred dollars, etc., to achieve fast detection speed and low cost , the effect of low labor cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1: Detection of ABCC2c.1249G>A (rs2273697) Gene Polymorphism Using High Resolution Melting Curve Analysis Technology
[0048] 1. Design primers:
[0049] Retrieve the sequence information of the human ABCC2c.1249G>A (rs2273697) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains the target sequence of the gene of interest A sequence consisting of 18-27 bp continuous nucleotides, the length of the PCR product is 80-150bp.
[0050] The sequence of the ABCC2c.1249G>A (rs2273697) gene:
[0051] rs2273697-F:TCAATCCTTATCTTTAGGCAT
[0052] rs2273697-R: ACAGTATCGCATTAATTGGG
[0053] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;
[0054] The test uses TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to supplement the P...
Embodiment 2
[0062] Example 2: Detection of ABCC23972C>T (rs3740066) gene polymorphism using high-resolution melting curve analysis technology
[0063] 1. Design primers:
[0064] Retrieve the sequence information of human ABCC23972C>T (rs3740066) gene from the nucleic acid database of the National Center for Biotechnology Information in the United States, and use PrimerPremier5 (Premier, Canada) software to design and screen suitable primer pairs; the primer pair contains 18- in the target sequence of the gene of interest A sequence composed of 27 bp continuous nucleotides, the length of the PCR product is 80-150bp;
[0065] The sequence of the ABCC23972C>T(rs3740066) gene is:
[0066] rs3740066-F: CAAATGATGAAGGCTTAGGG
[0067] rs3740066-R:CTGGGTGACTGATAAGAGGC
[0068] 2. Extract genomic DNA from peripheral blood cell samples for gene amplification;
[0069] Choose TaKaRaPremix solution, add DNA template and two primers to the solution, add pure water to make up the PCR reaction syste...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 