Non-diagnostic applications of two-dimensional graphdiyne materials for fluorescence detection of biomarkers

A biomarker and fluorescence detection technology, applied in the field of application, can solve the problems of simultaneous detection of multiple targets, low detection sensitivity, and long detection time, so as to increase the possibility of clinical detection, improve detection sensitivity, and reduce testing time. The effect of fees

Active Publication Date: 2018-10-09
INST OF PROCESS ENG CHINESE ACAD OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] With the continuous deepening of the research on fluorescent dye-labeled biological detection technology, the field of application of this technology has been continuously expanded to many fields such as environmental monitoring, drug discovery, clinical diagnosis, treatment and gene analysis. However, due to the limitation of detection materials, this technology is still There are the following main problems: low detection sensitivity, long detection time, and simultaneous detection of multiple targets cannot be achieved
However, there is no relevant literature on the use of graphyne in fluorescence detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Non-diagnostic applications of two-dimensional graphdiyne materials for fluorescence detection of biomarkers
  • Non-diagnostic applications of two-dimensional graphdiyne materials for fluorescence detection of biomarkers
  • Non-diagnostic applications of two-dimensional graphdiyne materials for fluorescence detection of biomarkers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] H1N1 influenza detection (gene sequence: CGACTACACTCTCGATGAAGAA)

[0036] In 930 μL of phosphate buffer (0.1M, pH7.4), 1.2nM probe DNA molecules (gene sequence: TTCTTCATCGAGAGTGTAGTCG-FAM) were hybridized with different concentrations (0-5nM) of target DNA, and left at room temperature for 1min. Add graphyne (20 μg ml -1) to stand for 1 minute. The relationship between the target DNA concentration and the detected signal intensity is as follows: image 3 As shown, the fluorescence spectrum analyzes the FAM fluorescence characteristic peak intensity change in the 494nm band, such as image 3 It can be seen that with the increase of the concentration of the target DNA, the detection signal obviously increases, and the minimum detection concentration of the graphyne material is 20pM.

Embodiment 2

[0038] Simultaneous detection of multiple genes, the gene sequences used are as follows:

[0039] H1N1 Influenza T1 (gene sequence: CGACTACACTCTCGATGAAGAA)

[0040] Probe DNA molecule P1 (gene sequence: TTCTTCATCGAGAGTGTAGTCG-FAM)

[0041] H5N1 Influenza T2 (gene sequence: CATACTGAGAACTCAAGAGTCT)

[0042] Probe DNA molecule P2 (gene sequence: AGACTCTTGAGTTCTCAGTATG-Texas Red)

[0043] M13 bacteriophage T3 (gene sequence: ACTGGGCCGTCGTTTTAC)

[0044] Probe DNA molecule P3 (gene sequence: GTAAAACGACGGCCAGT-ROX)

[0045] In 930 μL phosphate buffer (0.1M, pH7.4), 1.2 nM probe DNA molecules (P1, P2 and P3) were mixed with graphyne (20 μg ml -1 ) mix and let stand for 1 minute.

[0046] 1) Add target DNA (T1, T2 and T3) respectively. Fluorescence spectrum analysis of the characteristic peaks in the 494nm, 518nm and 595nm bands.

[0047] 2) Add T2 and T3 target DNA at the same time, and analyze the characteristic peaks in the band of 494nm to 595nm by fluorescence spectrum.

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention relates to an application of a two-dimensional graphdiyne material (with single layer or a plurality of layers) for a non-diagnosis purpose of biomarker fluorescence detection. Specifically, a biomarker includes a disease biomarker small-molecular compound, DNA, a nucleic acid aptamer, a protein, a peptide chain or other biological molecules. Through adopting of the two-dimensional graphdiyne material, the detection sensitivity can be substantially increased and the detection time is shortened at the same time, the use amount of specimens is reduced, the cost of testing is reduced, real-time detection of a variety of biological molecules can be realized simultaneously, and the two-dimensional graphdiyne material has broad application prospects for epidemic prevention of epidemic diseases such as influenza.

Description

technical field [0001] The invention relates to the application field of 2D nanometer materials, in particular to the non-diagnostic application of a two-dimensional graphyne material for fluorescence detection of biomarkers. Background technique [0002] Sensitive, rapid, highly selective and low-cost biomolecular analysis and detection platforms are important for the clinical diagnosis and treatment of diseases. Polymerase chain reaction is a typical amplification and sequencing method, but its high cost, high risk and time-consuming characteristics make it difficult to be widely promoted as a practical application system. In recent years, new technologies and methods of biological detection have emerged, including size-controllable semiconductor quantum dots, fluorescent and multi-metal barcodes and other detection systems, among which fluorescent dye-labeled biological detection technology is the most eye-catching. Fluorescence diagnosis mainly relies on the principle o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/64
CPCG01N21/6402
Inventor王丹金泉纳吉时·帕尔文
OwnerINST OF PROCESS ENG CHINESE ACAD OF SCI