Application of insulin-like growth factor binding protein 2 to promotion of adipose tissue regeneration
A technology of growth factors and binding proteins, applied in the field of stem cells, can solve problems such as unclear effects and mechanisms
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] (1) Acquisition and cultivation of stem cells
[0020] Purchase umbilical cord mesenchymal stem cells and inoculate the cells in 25cm 2 In a cell culture flask, culture in α-MEM medium (containing 15% fetal bovine serum, 2mmol / L glutamine, 100U / ml penicillin and 100μg / ml streptomycin) at 37°C, 5% CO2, every 2~ Change the medium once every 3 days. Cell growth was observed daily under an inverted microscope. When the cells grew to 80% confluence, they were digested and passaged with 0.25% trypsin at a ratio of 1:2.
[0021] (2) Construction of plasmid virus.
[0022] Query the gene sequence of IGFBP2 through the NCBI database, design PCR primers for the full length of the IGFBP2 gene, obtain the full length of IGFBP2 by PCR and add the surface marker FlagTag, connect it to the expression vector of retrovirus, sequence and identify, and finally construct into the plasmid of Flag-IGFBP2. Then carry out virus packaging, collection, virus titer identification, and store ...
Embodiment 2
[0026] Real-time RT-PCR:
[0027] 1. Primer design, biological software such as Primer3 and oligo6.
[0028] 2. RT-PCR primer sequence:
[0029] IGFBP2-F: CGTTCAAGTGCAAGATGTCTCTGAACG
[0030] IGFBP2-R: GGATCAGCTTCCCGGTGTTG
[0031] 3. RNA extraction
[0032] 1) Discard the supernatant of the cells in the culture dish, wash with PBS twice, add 700ul QIAZOL, pipette and mix well, collect in EP tube, incubate at room temperature for 5min, add 140ul chloroform, shake vigorously for 15s, incubate at room temperature for 3min, centrifuge at 12000g at 4°C for 15min, Collect the supernatant in a new EP tube;
[0033] 2) Take 700ul sample to RNeasyRNA extraction column, centrifuge at 8000g at 4°C for 15s, and discard the lower liquid;
[0034] 3) Add 700ul BufferRWT to the RNA extraction column, centrifuge at 8000g at 4°C for 15s, discard the lower liquid;
[0035] 4) Add 500ul BufferRPE to RNeasyMinicolumn, centrifuge at 8000g at 4°C for 15s, and discard the lower liquid;
[00...
Embodiment 3
[0055] Western Blot
[0056] 1. Extraction of total cell protein
[0057] 1) Discard the medium, rinse the cells twice with 5ml PBS pre-cooled at 4°C, add 5ml PBS, scrape off the cells in the culture dish with the cells, collect them in a 15ml centrifuge tube, centrifuge at 1100rpm for 6min; discard the supernatant, add 1ml PBS to resuspend Cells were collected in EP tubes and centrifuged at 7200rpm for 2min;
[0058] 2) Discard the supernatant, add lysate (100ulRIPA+1ulPMSF+1ulPIC) at a volume ratio of 1:5 (cell: lysate), place on ice for 15min, and suspend every 2-3min;
[0059] 3) Centrifuge at 14,000 rpm for 15 minutes at 4°C, collect the supernatant in a new EP tube, and store at -80°C.
[0060] 2. Determination of protein concentration by Bradford method
[0061] 1) The BSA protein standard was diluted with double distilled water sequentially according to the instructions, so that the final concentrations were 1000 μg / ml, 750 μg / ml, 500 μg / ml, 250 μg / ml, 125 μg / ml, 62...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com