Transcription activator like effector nuclease and application thereof

A technology of transcriptional activators and effectors, applied in the field of bioengineering, can solve problems such as the need to improve the expression of GHR

Inactive Publication Date: 2016-04-27
SHENZHEN HUADA GENE INST +1
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, current research on GH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transcription activator like effector nuclease and application thereof
  • Transcription activator like effector nuclease and application thereof
  • Transcription activator like effector nuclease and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1: Construction and activity detection of TALEN vector (cleavage construct) for identifying GHR gene locus

[0048] Vector build:

[0049]Analyze the GHR site sequence, select TCCTTGTCAGAGCATCTCAGAGTCTGCAGAGAGTTCATCCAGGCCTAGAGA (SEQ ID NO: 1) as the TALEN vector recognition splicing sequence, SEQ ID NO: 1 recognizes a sequence of exon 2 of the GHR gene, and there is a natural PstI restriction site in the middle of the recognition sequence, which can For enzyme digestion identification. Specifically, TALEN1 recognizes TCCTTGTCAGAGCATCTC (SEQ ID NO: 2), that is, the sequence of assembled TALEN1 modules is: HD-HD-NG-NG-NN-NG-HD-NI-NN-NI-NN-HD-NI-NG-HD- NG-HD (SEQ ID NO: 7); TALEN2 recognizes the reverse complementary sequence of TCATCCAGGCCTAGAGA (SEQ ID NO: 3), and the module sequence for assembling TALEN2 is: HD-NG-HD-NG-NI-NN-NN-HD-HD-NG- NN-NN-NI-NG-NN-NI (SEQ ID NO: 8).

[0050] Then, construct the TALEN expression backbone vector according to the following...

Embodiment 2

[0062] Example 2: Transfection screening and identification of GHR target cells

[0063] Extract endotoxin-free TALENs plasmid and pcDNA3.1(+). The pcDNA3.1(+) vector was digested with AhdI to linearize it. The TALENs plasmid and pcDNA3.1(+) linearized fragment were co-transfected into Bama pig fetal fibroblasts by nuclear transfer method, and the transfection ratio was 2 μg TALENs:0.8 μg pcDNA3.1(+) linearized fragment.

[0064] Divide the transfected cells to 10cm, and use 500μg / ml G418 to screen the cells. After 1 week of screening, positive clones appear, pick the positive clones to a 48-well plate and continue to expand the culture, and change the concentration of 200μg / ml G418 maintain. It should be noted that the lethal concentration of G418 is different for different cell lines, so the lethal concentration of G418 must be measured for the cell lines first. The lethal concentration of G418 for the Bama fibroblast cell line in this example is 500 μg / ml.

[0065] Cells...

Embodiment 3

[0075] Example 3 Manual cloning to obtain transgenic piglets

[0076] The specific process is as follows:

[0077] Obtain the Bama pig ovary, collect the ovum, and wash it in the improved TL-Hepes-PVA buffer, put it into a culture plate, and carry out in vitro maturation (invitromaturation, IVM) culture of immature egg cells in an incubator to obtain mature eggs. Among them, the formula of the improved TL-Hepes-PVA buffer is: 114MNaCl, 3.2MKCl, 0.34MNaH 2 PO 4 , 10M sodium lactate, 0.50MMgCl 2 ·6H 2 O, 10M Hepes, 0.2M Sodium Pyruvate, 12M Sorbitol, 2M Na 2 HCO 3 , 2MCaCl 2 2H 2 O, 0.01 volume % PVA.

[0078] Then, the obtained mature eggs are enucleated with a small blade under a microscope to obtain mature enucleated oocytes. Next, pick a single GHR-16 clone cell line cell, and fuse it into a mature enucleated oocyte using a fusion instrument to make a reconstructed embryo. Then the reconstituted embryos are put into the incubator and cultured for 5-6 days to form ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a transcription activator like effector nuclease and application thereof. Growth hormone receptor gene is recognized based on specificity of the transcription activator like effector nuclease. The transcription activator like effector nuclease is used for effectively realizing fixed-point gene knockout to animal growth hormone receptor (GHR) so as to effectively interfere with growth axis path of animals.

Description

technical field [0001] The present invention relates to the field of bioengineering, in particular, to transcription activator-like effector nuclease and its application, more specifically, to transcription activator-like effector nuclease, polynucleotide, construct, cell, preparation of transgenic animals The method and the method for screening drugs for treating dwarfism. Background technique [0002] Generally, the growth of animals such as humans, pigs, and mice is regulated by the growth axis. The growth axis is a neuroendocrine system composed of a series of hormones and their receptors from the hypothalamus-pituitary-target organ in animals, consisting of growth hormone releasing factor (GRF), growth hormone (GH) and insulin-like growth factor ( IGF) composition. The hypothalamus secretes growth hormone releasing hormone (growth hormone releasing hormone, GHRH) and somatostatin (somatostatin, SS) according to the needs of the body, with dual effects on the pituitary...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/22C12N15/55C12N15/85C12N5/10C12N15/873A01K67/027A61K49/00
Inventor 李飞达李勇张欢欢田凯刘楚新刘欢张兴举杜玉涛
Owner SHENZHEN HUADA GENE INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap