Drug molecule for antagonizing TLR7/8 and TLR9 activation and application
A technology of drug molecules and uses, applied in the direction of drug combination, drug delivery, sugar derivatives, etc., can solve the problems of high price and complicated preparation process, and achieve improvement of pathological damage, good safety, clear action target and treatment location Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Embodiment 1: preparation of injection
[0022] Drug name: c41 molecule
[0023] Sequence structure: TGGCGCGCACCCACGGCCTG
[0024] Modification structure:
[0025] (* is thio modification)
[0026] Preparation method: chemical synthesis, entrusted to Shanghai Shenggong Company. Yield, purified by HPLC, vacuumed, stored in glass bottles at room temperature, and packed at 330 μg / bottle (dry powder).
[0027] Usage configuration: Take a small bottle, inject 600μl of normal saline, dilute and mix well, set aside.
Embodiment 2
[0028] Example 2: Identification of c41 molecule inhibiting the activation of TLR7 / 8 and 9
[0029] 2.1 Main materials, reagents and equipment:
[0030] 1) Cell line: RAW264.7 (ATCC, USA.).
[0031] 2) Cell culture medium: DMEM (Gibco, Inc., USA).
[0032] 3) Elisa kit: anti-mouse TNF-a (eBioscience, Inc., USA).
[0033] 4) Cell incubator: FORMA3111.
[0034] 5) Microplate reader: full-wavelength multifunctional microplate reader (ThermoScientific, USA).
[0035] 2.2 Experimental method: Dilute RAW264.7 cells to 1×10 6 / mL, added to a 96-well plate (200 μL / well), placed at 37 ° C, 5% CO 2 After culturing in the incubator for 2 hours, the TLR7 / 8 agonist R848 (5 μl, final concentration 100 ng / ml) was added as the experimental group; the TLR9 agonist CpG-ODN18265 μl (5 μl, final concentration 4 μM) was added as the second experimental group. Set 8 multiple wells. Then, each component is divided into 4 multiple wells, and 5 μl of culture solution is added, respectively as a...
Embodiment 3
[0037] Example 3: Subcutaneous injection in the treatment of psoriasis and its curative effect.
[0038] 3.1 Main materials, reagents and equipment:
[0039] 1) Animal: Balb / c (Huafukang Biotechnology Co., Ltd., China).
[0040] 2) Modeling drug: imiquimod (Mingxin Pharmaceutical, China).
[0041] 3) Therapeutic drug: injection according to the present invention (see Example 1 for details)
[0042] 3.2 Experimental method:
[0043] 1) After the mice were shaved, the psoriasis model was established on the back of the mice after shaving, 20mg / cm2, once a day, for 6 days.
[0044] 2) Grouping: placebo group and drug treatment group, each with 5 rats.
[0045] 3) Administration: placebo group: subcutaneous injection of normal saline (NS), 100 μl / 20g body weight; treatment group: C41 drug of the present invention diluted to 550 μg / ml with NS and subcutaneous injection of C41 molecule 100 μl / 20g body weight.
[0046] 4) Each group starts treatment from the first day and lasts f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 