Unlock instant, AI-driven research and patent intelligence for your innovation.

Drug molecule for antagonizing TLR7/8 and TLR9 activation and application

A technology of drug molecules and uses, applied in the direction of drug combination, drug delivery, sugar derivatives, etc., can solve the problems of high price and complicated preparation process, and achieve improvement of pathological damage, good safety, clear action target and treatment location Effect

Inactive Publication Date: 2016-05-04
THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation process is complex and expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug molecule for antagonizing TLR7/8 and TLR9 activation and application
  • Drug molecule for antagonizing TLR7/8 and TLR9 activation and application
  • Drug molecule for antagonizing TLR7/8 and TLR9 activation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Embodiment 1: preparation of injection

[0022] Drug name: c41 molecule

[0023] Sequence structure: TGGCGCGCACCCACGGCCTG

[0024] Modification structure:

[0025] (* is thio modification)

[0026] Preparation method: chemical synthesis, entrusted to Shanghai Shenggong Company. Yield, purified by HPLC, vacuumed, stored in glass bottles at room temperature, and packed at 330 μg / bottle (dry powder).

[0027] Usage configuration: Take a small bottle, inject 600μl of normal saline, dilute and mix well, set aside.

Embodiment 2

[0028] Example 2: Identification of c41 molecule inhibiting the activation of TLR7 / 8 and 9

[0029] 2.1 Main materials, reagents and equipment:

[0030] 1) Cell line: RAW264.7 (ATCC, USA.).

[0031] 2) Cell culture medium: DMEM (Gibco, Inc., USA).

[0032] 3) Elisa kit: anti-mouse TNF-a (eBioscience, Inc., USA).

[0033] 4) Cell incubator: FORMA3111.

[0034] 5) Microplate reader: full-wavelength multifunctional microplate reader (ThermoScientific, USA).

[0035] 2.2 Experimental method: Dilute RAW264.7 cells to 1×10 6 / mL, added to a 96-well plate (200 μL / well), placed at 37 ° C, 5% CO 2 After culturing in the incubator for 2 hours, the TLR7 / 8 agonist R848 (5 μl, final concentration 100 ng / ml) was added as the experimental group; the TLR9 agonist CpG-ODN18265 μl (5 μl, final concentration 4 μM) was added as the second experimental group. Set 8 multiple wells. Then, each component is divided into 4 multiple wells, and 5 μl of culture solution is added, respectively as a...

Embodiment 3

[0037] Example 3: Subcutaneous injection in the treatment of psoriasis and its curative effect.

[0038] 3.1 Main materials, reagents and equipment:

[0039] 1) Animal: Balb / c (Huafukang Biotechnology Co., Ltd., China).

[0040] 2) Modeling drug: imiquimod (Mingxin Pharmaceutical, China).

[0041] 3) Therapeutic drug: injection according to the present invention (see Example 1 for details)

[0042] 3.2 Experimental method:

[0043] 1) After the mice were shaved, the psoriasis model was established on the back of the mice after shaving, 20mg / cm2, once a day, for 6 days.

[0044] 2) Grouping: placebo group and drug treatment group, each with 5 rats.

[0045] 3) Administration: placebo group: subcutaneous injection of normal saline (NS), 100 μl / 20g body weight; treatment group: C41 drug of the present invention diluted to 550 μg / ml with NS and subcutaneous injection of C41 molecule 100 μl / 20g body weight.

[0046] 4) Each group starts treatment from the first day and lasts f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a drug molecule for antagonizing TLR7 / 8 and TLR9 activation. The drug molecule is of a phosphorothioate modified molecule structure containing a sequence shown as SEQ ID NO: 1. The drug molecule is capable of antagonizing TLR7 / 8 and TLR9 activation and restraining release of proinflammatory factors such as TNF and IL to achieve the inflammation restraining effect; the drug molecule and normal saline are prepared into injection, treatment is conducted in a subcutaneous injection mode, and pathological injury of psoriasis can be remarkably relieved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a drug molecule for antagonizing the activation of TLR7 / 8 and TLR9 and its use. Background technique [0002] Psoriasis, commonly known as psoriasis, is a common chronic inflammatory skin disease in clinical practice. It occurs more frequently in young and middle-aged people, with a longer course of disease and easy recurrence. It presents progressive skin lesions and thickened keratin. The clinical manifestations are mainly erythema and scales, and the whole body can be affected. [0003] Although it was early recognized that the disease is an autoimmune disease related to heredity and infection. However, the specific pathogenic mechanism is not clear, so there is no specific drug at present, and non-specific drug treatment is mainly used to soften the stratum corneum as a symptomatic strategy, or a treatment plan that uses a small amount of hormones as an auxiliary trea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07H21/00A61K31/713A61P17/06
CPCC07H21/00A61K9/0019A61K31/713
Inventor 李彦刘万成王宁杨希川刘鑫
Owner THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA