Actinomycete signal peptide for expressing intracellular protein to extracellular position and application thereof

An intracellular protein and signal peptide technology, applied in the field of genetic engineering, can solve the problems of low versatility of high-efficiency secretion and expression, no report on recombinant secretion and expression of Escherichia coli, etc. active effect

Inactive Publication Date: 2016-09-07
SHANDONG UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the signal peptides used for heterologous expression in Escherichia coli are generally derived from Escherichia coli itself or Bacillus, but most of them have the defect of low versatility in high-efficiency secretion expression, which leads to the need to carry out a lot of signal peptide screening work before selection
The signal peptide involved in this patent comes from actinomycetes. According to the search, there is no report on the use of the signal peptide derived from the actinomycete Kukia coli for recombinant secretion and expression in E. coli.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Actinomycete signal peptide for expressing intracellular protein to extracellular position and application thereof
  • Actinomycete signal peptide for expressing intracellular protein to extracellular position and application thereof
  • Actinomycete signal peptide for expressing intracellular protein to extracellular position and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1: Construction of chemical method recombinant strain

[0029] Competent state preparation: chemical method (Ca Cb) method

[0030] Add 1% inoculum of BL21 overnight culture to 50ml LB; measure OD600nm every 15-20min, and collect the bacteria when it grows to 0.3-0.4; place the culture on ice for 10min, then pour it into a 50ml centrifuge tube , 4°C, 4500rpm, centrifuge for 10min (the 50ml centrifuge tube also needs to be pre-cooled, adjust the centrifuge to 4°C in advance); discard the supernatant, and use 30ml of pre-cooled 0.1M MgCl 2 -CaCl 2 Resuspend the cell pellet in the solution; centrifuge at 4500rpm for 10min at 4°C; discard the supernatant, and add 2ml of pre-cooled 0.1M CaCl to the 50ml initial culture medium 2 Solution (15% glycerol) to resuspend the cell pellet; aliquot 50 μl / tube or 100 μl / tube, and store at -70°C.

[0031] Ligation system: 4 μl of carrier, 5.5 μl of target fragment, T 4 DNA ligase 0.5 μl, T 4 DNA ligase Buffer 1μl; ligati...

Embodiment 2

[0032] Embodiment 2: Construction of FSA and SFSA recombinant strain

[0033] The full length of FSA amylase gene is 1359bp. Primers were designed according to the signal peptide sequence, and the signal peptide sequence was recombined with the gene sequence shown in KC441955.1 to obtain the fusion gene fragment SFSA. Among them: one round of PCR amplified the upper and lower fragments respectively, and the primers were SFSA-F1: GAGGATCCGATGAGCAGACGAGC, SFSA-R1: GCGAGCGCCGATGACAATAATAATTATAC; SFSA-F2: GTATAATTATTATTGTCATCGGCGCTCGC, SFSA-R2: GACGTCGACTTACTCTCCCGAAACCGACCATATG. The two groups of PCR products were recovered by gel cutting, the concentration of the recovered products was measured, and water was added to adjust the concentration of the upstream and downstream homology arms to be basically the same; the two rounds of PCR used the first round of PCR products as primers and templates to connect the two amplification products, The PCR products were recovered; the 3 ro...

Embodiment 3

[0037] Embodiment 3: Construction of BLA and SBLA recombinant strain

[0038] The full length of the BLA amylase gene is 1455bp. Primers were designed according to the signal peptide sequence, and the signal peptide sequence was recombined with the gene sequence shown in AAU39594 to obtain the fusion gene fragment SBLA, in which the upper and lower fragments were amplified in one round of PCR, and the primers were SBLA-F1: GAGGATCCGATGAGCAGACGAGC, SBLA- R1: CTTTAAGATTTGCCGCGGCGCTCG; SBLA-F2: GCGAGCGCCGCGGCAAATCTTAAAG, SBLA-R2: CCCAAGCTTGGGCTATCTTTGAACATAAATTG. The two groups of PCR products were recovered by gel cutting, the concentration of the recovered products was measured, and water was added to adjust the concentration of the upstream and downstream homology arms to be basically the same; the two rounds of PCR used the first round of PCR products as primers and templates to connect the two amplification products, The PCR products were recovered; the 3 rounds of PCR used...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an actinomycete signal peptide for expressing intracellular protein to an extracellular position. The actinomycete signal peptide is named as Kp-SP, and is from a Kocuria sp.3-3 strain; the nucleotide sequence of the actinomycete signal peptide is shown as SEQ ID No.1, and the amino acid sequence is shown as SEQ ID No.7. The invention also discloses application of the signal peptide to the expression of amylase or cellulose by using the built recombinant escherichia coli. The signal peptide has the capability of secreting foreign protein to the extracellular position in a normal expression carrier, so that the protein expression quantity is increased; the enzyme activity is obviously improved; in addition, the foreign protein extracellular secretion capability is also realized in the constitutive expression carrier pBSPPc; an effective path is provided for producing high-activity secretion protein. As a basic gene engineering technology, the invention provides the favorable conditions for the industrial protein production; the protein expression quantity and the enzyme activity are enhanced; the separation cost is reduced; great application prospects are realized in the protein industrial production aspect.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a signal peptide for expressing intracellular protein to the outside of the cell and its application in expressing amylase and cellulase using constructed recombinant Escherichia coli. Background technique [0002] Gene expression refers to the transformation of genetic information stored in DNA sequences into biologically active protein molecules through transcription and translation during the life process of cells; the expression of foreign proteins in genetic engineering technology refers to the acquisition of foreign genes Fragments are recombined into a new gene expression host through a vector, so that it can produce a large amount of biologically active protein products, which is one of the most widely used technical means in the field of molecular biology today. With the development of bioindustrial production processes, people's demand for high-purity, high-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/195C12N9/26C12N9/42C12N15/70C12R1/19
CPCC07K14/195C12N9/2411C12N9/2437C12N15/70C12N2800/101
Inventor杨春玉崔延冰
OwnerSHANDONG UNIV