Check patentability & draft patents in minutes with Patsnap Eureka AI!

Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase

A technology of alginate lyase and ocean, applied in lyase, carbon-oxygen lyase, application, etc., can solve problems such as weak research foundation, achieve wide application prospects, and improve enzyme activity

Inactive Publication Date: 2016-06-08
SHANDONG UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current research foundation of alginate lyase is weak, and there are few industrial enzyme preparations of alginate lyase developed. The lack of industrial enzymes for alginate lyase has become a bottleneck for the high-value processing of brown algae and alginic acid.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase
  • Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase
  • Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Acquisition and sequence analysis of the gene sequence encoding alginate lyase GC

[0029] Strain source: strain GlaciecolachathamensisS18K6 T Purchased from the Japan Collection of Microorganisms with the accession number 13645.

[0030] Specific steps are as follows:

[0031] 1.1 Screening of strains

[0032] Take the pure cultured strain, plant it on the separation medium plate, cultivate it at 15°C for 48 hours, and measure the diameter of the strain. Then add 5mL of 10wt% cetylpyridinium chloride solution, gently rotate the plate to make the solution evenly cover the entire plate, let it stand for 10min to fully stain, then rinse the surface of the medium with water to remove the cetylpyridinium chloride solution, measure the diameter of the transparent circle, and calculate The diameter ratio of the transparent circle to the colony.

[0033] 1.2 Determination of the GC gene sequence of alginate lyase

[0034] Select the strain GC that produces a tr...

Embodiment 2

[0045] Example 2: Cloning, heterologous expression and isolation and purification of alginate lyase GC

[0046] 2.1 Using PCR to amplify the gc gene sequence

[0047](1) According to the online prediction of the signal peptide, the alginate lyase gene gc includes a signal peptide encoded by 84 nucleotides, the signal peptide is excised, and two specific primers are designed according to the gene gc sequence:

[0048] gcF:GGAATTC CATATG GCTGACTTGCTTGTTAAGACACCA (SEQ ID NO.3), underlined is the NdeI restriction site; SEQ ID NO.3

[0049] gcR:CCC AAGCTT TTAAAGGACTGTATTGCCGCTTATTG (SEQ ID NO.4), underlined is the HindIII restriction site; SEQ ID NO.4

[0050] Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0051] (2) Using gcF and gcR as primers, strain S18K6 T DNA as a template, using FastPfuDNA polymerase (purchased from Transgen Company) to amplify the target gene fragment;

[0052] The PCR reaction conditions are: pre-denaturation at 95°C for 2min...

Embodiment 3

[0071] Example 3: Determination of properties of alginate lyase GC

[0072] 3.1 Optimum temperature analysis

[0073] The standard response is:

[0074] 80 μl of 5 mg / l sodium alginate (purchased from Sigma) substrate and 100 μl of 50 mM Tris-HCl (pH 8.0) mixture were preheated at 20°C for 5 minutes, then 20 μl of the diluted enzyme solution was added and reacted at 20°C for 30 minutes, boiled water bath 5min to terminate the reaction. Determination of OD 235 Value, the reaction without enzyme solution was used as the blank control. Enzyme activity unit (U) is defined as: the amount of enzyme required to produce products per minute at a certain temperature to increase the absorbance at 235nm by 0.1.

[0075] Determination of the optimum reaction temperature: using sodium alginate as a substrate, in Tris-HCl (pH8.0) buffer solution with a final concentration of 25mM, detect the temperature of alginate lyase GC at 0°C, 10°C, 20°C, Enzyme activity at 30°C, 40°C, 50°C. The h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an ocean alginate lyase, an expression gene thereof and application of the ocean alginate lyase. Nucleotide sequences of ocean alginate lyase genes gc are shown as SEQ ID NO.1, and amino acid sequences of the ocean alginate lyase GC with codes of the ocean alginate lyase genes gc are shown as SEQ ID NO.2. The ocean alginate lyase, the expression gene and the application have the advantages that the alginate lyase GC is obtained for the first time, and a three-dimensional structure of the ocean alginate lyase GC is analyzed by the aid of crystals obtained by a crystallization method from the ocean alginate lyase; crystal structures of the ocean alginate lyase GC can have broad application prospects in the aspects of modifying substrates in industrial enzyme preparations, improving the enzyme activity and the like.

Description

technical field [0001] The invention relates to a marine alginic acid lyase and its expression gene and application, belonging to the technical field of biotechnology. Background technique [0002] my country has a vast sea area and rich seaweed resources, and is the world's largest seaweed producer. Among them, brown algae is the most developed species, accounting for about 75% of the total algae output. Alginic acid is a unique biologically active polysaccharide in brown algae. As a natural biological macromolecule, it has been widely used in food, medicine, chemical industry and other fields. However, alginic acid has a large molecular weight and strong gelation properties, which are greatly restricted in terms of production, processing and comprehensive utilization. The hydrolyzed alginate oligosaccharides have good water solubility and have various biological activities such as antibacterial, antitumor, immune regulation, lowering blood sugar and blood lipids, and reg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12P19/00C12R1/19
CPCC12N9/88C12P19/00C12Y402/02003C12Y402/02011
Inventor 陈秀兰张玉忠徐菲董方李平一张熙颖苏海楠周百成
Owner SHANDONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More