Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase
A technology of alginate lyase and ocean, applied in lyase, carbon-oxygen lyase, application, etc., can solve problems such as weak research foundation, achieve wide application prospects, and improve enzyme activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Acquisition and sequence analysis of the gene sequence encoding alginate lyase GC
[0029] Strain source: strain GlaciecolachathamensisS18K6 T Purchased from the Japan Collection of Microorganisms with the accession number 13645.
[0030] Specific steps are as follows:
[0031] 1.1 Screening of strains
[0032] Take the pure cultured strain, plant it on the separation medium plate, cultivate it at 15°C for 48 hours, and measure the diameter of the strain. Then add 5mL of 10wt% cetylpyridinium chloride solution, gently rotate the plate to make the solution evenly cover the entire plate, let it stand for 10min to fully stain, then rinse the surface of the medium with water to remove the cetylpyridinium chloride solution, measure the diameter of the transparent circle, and calculate The diameter ratio of the transparent circle to the colony.
[0033] 1.2 Determination of the GC gene sequence of alginate lyase
[0034] Select the strain GC that produces a tr...
Embodiment 2
[0045] Example 2: Cloning, heterologous expression and isolation and purification of alginate lyase GC
[0046] 2.1 Using PCR to amplify the gc gene sequence
[0047](1) According to the online prediction of the signal peptide, the alginate lyase gene gc includes a signal peptide encoded by 84 nucleotides, the signal peptide is excised, and two specific primers are designed according to the gene gc sequence:
[0048] gcF:GGAATTC CATATG GCTGACTTGCTTGTTAAGACACCA (SEQ ID NO.3), underlined is the NdeI restriction site; SEQ ID NO.3
[0049] gcR:CCC AAGCTT TTAAAGGACTGTATTGCCGCTTATTG (SEQ ID NO.4), underlined is the HindIII restriction site; SEQ ID NO.4
[0050] Primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0051] (2) Using gcF and gcR as primers, strain S18K6 T DNA as a template, using FastPfuDNA polymerase (purchased from Transgen Company) to amplify the target gene fragment;
[0052] The PCR reaction conditions are: pre-denaturation at 95°C for 2min...
Embodiment 3
[0071] Example 3: Determination of properties of alginate lyase GC
[0072] 3.1 Optimum temperature analysis
[0073] The standard response is:
[0074] 80 μl of 5 mg / l sodium alginate (purchased from Sigma) substrate and 100 μl of 50 mM Tris-HCl (pH 8.0) mixture were preheated at 20°C for 5 minutes, then 20 μl of the diluted enzyme solution was added and reacted at 20°C for 30 minutes, boiled water bath 5min to terminate the reaction. Determination of OD 235 Value, the reaction without enzyme solution was used as the blank control. Enzyme activity unit (U) is defined as: the amount of enzyme required to produce products per minute at a certain temperature to increase the absorbance at 235nm by 0.1.
[0075] Determination of the optimum reaction temperature: using sodium alginate as a substrate, in Tris-HCl (pH8.0) buffer solution with a final concentration of 25mM, detect the temperature of alginate lyase GC at 0°C, 10°C, 20°C, Enzyme activity at 30°C, 40°C, 50°C. The h...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
