Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase

A technology of alginate lyase and ocean, applied in lyase, carbon-oxygen lyase, application, etc., can solve problems such as weak research foundation, achieve wide application prospects, and improve enzyme activity

Inactive Publication Date: 2016-06-08
SHANDONG UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current research foundation of alginate lyase is weak, and there are few industrial enzyme preparations of alginate lyase develo

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase
  • Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase
  • Ocean alginate lyase, expression gene thereof and application of ocean alginate lyase

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0028] Example 1: Acquisition and sequence analysis of the GC-encoding gene sequence of alginate lyase

[0029] Source of strain: strain GlaciecolachathamensisS18K6 T It was purchased from the Japan Collection of Microorganisms, and the deposit number is 13645.

[0030] Specific steps are as follows:

[0031] 1.1 Screening of strains

[0032] Take the pure cultured strains, spot them on the separation medium plate, cultivate at 15°C for 48h, and measure the diameter of the strains. Then add 5mL of 10wt% cetylpyridinium chloride solution, gently rotate the plate to spread the solution evenly over the entire plate, let it stand for 10min to fully stain, then rinse the medium surface with water to remove the cetylpyridinium chloride solution, measure the diameter of the transparent circle, and calculate The diameter ratio of the transparent circle to the colony.

[0033] 1.2 Determination of Alginate Lyase GC Gene Sequence

[0034] Select the strain GC that produces a transparent degradat...

Example Embodiment

[0045] Example 2: Cloning, heterologous expression, separation and purification of alginate lyase GC

[0046] 2.1 Use PCR to amplify the gc gene sequence

[0047] (1) According to the signal peptide online prediction, the alginate lyase gene gc includes a signal peptide encoded by 84 nucleotides. The signal peptide is excised, and two specific primers are designed according to the gene gc sequence:

[0048] gcF:GGAATTC CATATG GCTGACTTGCTTGTTAAGACACCA (SEQIDNO.3), the NdeI restriction site is underlined; SEQIDNO.3

[0049] gcR:CCC AAGCTT TTAAAGGACTGTATTGCCGCTTATTG (SEQIDNO.4), the HindIII restriction site is underlined; SEQIDNO.4

[0050] The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0051] (2) Using gcF and gcR as primers, using strain S18K6 T DNA as template, use FastPfuDNA polymerase (purchased from Transgen) to amplify the target gene fragment;

[0052] PCR reaction conditions are: pre-denaturation at 95°C for 2min; then denaturation at 95°C for 30sec,...

Example Embodiment

[0071] Example 3: Determination of the properties of alginate lyase GC

[0072] 3.1 Optimal temperature analysis

[0073] The standard response is:

[0074] 80μl of 5mg / l sodium alginate (purchased from Sigma) substrate and 100μl of 50mM Tris-HCl (pH8.0) mixed solution at 20℃ for 5min, add 20μl of diluted enzyme solution and react at 20℃ for 30min, boiling water bath The reaction was terminated in 5 minutes. Determine OD 235 Value, take the reaction without adding enzyme solution as a blank control. Enzyme activity unit (U) is defined as the amount of enzyme required to produce a product per minute at a certain temperature to increase the absorbance at 235nm by 0.1.

[0075] Determination of the optimum reaction temperature: Using sodium alginate as a substrate, in a Tris-HCl (pH 8.0) buffer with a final concentration of 25 mM, the alginate lyase GC was tested at 0℃, 10℃, 20℃, Enzyme activity at 30°C, 40°C, and 50°C. The highest enzyme activity is defined as 100%.

[0076] The resu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an ocean alginate lyase, an expression gene thereof and application of the ocean alginate lyase. Nucleotide sequences of ocean alginate lyase genes gc are shown as SEQ ID NO.1, and amino acid sequences of the ocean alginate lyase GC with codes of the ocean alginate lyase genes gc are shown as SEQ ID NO.2. The ocean alginate lyase, the expression gene and the application have the advantages that the alginate lyase GC is obtained for the first time, and a three-dimensional structure of the ocean alginate lyase GC is analyzed by the aid of crystals obtained by a crystallization method from the ocean alginate lyase; crystal structures of the ocean alginate lyase GC can have broad application prospects in the aspects of modifying substrates in industrial enzyme preparations, improving the enzyme activity and the like.

Description

technical field [0001] The invention relates to a marine alginic acid lyase and its expression gene and application, belonging to the technical field of biotechnology. Background technique [0002] my country has a vast sea area and rich seaweed resources, and is the world's largest seaweed producer. Among them, brown algae is the most developed species, accounting for about 75% of the total algae output. Alginic acid is a unique biologically active polysaccharide in brown algae. As a natural biological macromolecule, it has been widely used in food, medicine, chemical industry and other fields. However, alginic acid has a large molecular weight and strong gelation properties, which are greatly restricted in terms of production, processing and comprehensive utilization. The hydrolyzed alginate oligosaccharides have good water solubility and have various biological activities such as antibacterial, antitumor, immune regulation, lowering blood sugar and blood lipids, and reg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12P19/00C12R1/19
CPCC12N9/88C12P19/00C12Y402/02003C12Y402/02011
Inventor 陈秀兰张玉忠徐菲董方李平一张熙颖苏海楠周百成
Owner SHANDONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap