Recombinant escherichia coli efficiently transforming fumaric acid into L-asparagine as well as construction method and application thereof

A technology for recombining Escherichia coli and fumaric acid, applied in the field of bioengineering, can solve the problems of intractable waste water, large pollution, low product yield and the like, and achieve the effects of reducing production cost, reducing production and improving conversion yield

Active Publication Date: 2016-09-07
NANJING UNIV OF TECH
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the production of L-asparagine is mainly made from L-aspartic acid through esterification and ammonolysis, but the yield of the process product is low, and a large amount of organic solvent is involved, which causes great pollution and difficult treatment of waste water.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli efficiently transforming fumaric acid into L-asparagine as well as construction method and application thereof
  • Recombinant escherichia coli efficiently transforming fumaric acid into L-asparagine as well as construction method and application thereof
  • Recombinant escherichia coli efficiently transforming fumaric acid into L-asparagine as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] This example illustrates the process of knocking out the fumarase fumB gene in the parental ammonium-resistant Escherichia coli BEW308 by using homologous recombination technology to obtain an apramycin-resistant strain.

[0033] (1) Using LB medium, cultivate Escherichia coli BEW308 to OD at 37°C under aerobic conditions 600 =0.4~0.6, prepared as electrotransfer competent;

[0034] (2) The pKD46 plasmid was electrotransformed into competent Escherichia coli BEW308. The electric shock conditions are: 200Ω, 25μF, electric shock voltage 2.3kv, electric shock time 4-5ms. Immediately after the electric shock, the bacteria were added to pre-cooled 1mL SOC medium, cultured at 150r / min, 30°C for 1h, and then spread on the LB medium plate with ampicillin (amp) to screen out the positive transformant BEW308 (pKD46);

[0035] (3) Adding 10 mM L-arabinose to LB medium, inducing plasmid pKD46 to express λ recombinase at 30°C to make electroporation competent;

[0036] (4) Using ...

Embodiment 2

[0046] Example 2: In this example, the effect of mutation on the L-aspartase gene (aspC) of Escherichia coli K12 on the enzyme activity was investigated. The specific operation process is: based on the original aspC, the 236 and 249 amino acids are mutated (Lys236Asn, Gly249Thr), and the gene is synthesized by artificial synthesis, named aspC2. The mutated gene was connected to the pTrc99a expression plasmid and introduced into BEW308 (ΔfumB), and BEW308 (ΔfumB, aspC2) was constructed to obtain BEW308 (ΔfumB, aspC2) for comparison with the mutated recombinant strain BEW308 (ΔfumB, aspC). The results are shown in Table 1:

[0047] Table 1 Changes in enzymatic properties of aspartase before and after mutation

[0048] enzyme

Embodiment 3

[0050] This example illustrates the use of homologous recombination to further knock out the fumarase fumAC gene in Escherichia coli BEW308 (ΔfumB), and introduce mutated highly active L-aspartase and L-asparaginase genes.

[0051] The whole experimental operation process is consistent with Example 1, only the homologous sequence is different.

[0052] (1) In this example, the L-aspartase gene (aspC) of Escherichia coli K12 is used as the starting sequence, and the 236 and 249 amino acids are mutated to obtain aspC2, namely Lys236Asn, Gly249Thr, and at the same time upstream of the initiation codon ATP A signal peptide sequence has been added: atgttgaatccgaaggttgcctacatggtctggatgacgtgcctgggtttaacgttgcccagccaggca (shown in SEQ ID NO: 3), the stop codon has been deleted downstream; the coding L-asparaginase gene (asnA), its start codon and L-aspartate There is a 30bp connection sequence between the end genes of the acidase gene to ensure that the two enzymes have high activity a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant escherichia coli efficiently transforming fumaric acid into L-asparagine as well as a construction method and an application thereof. Fumarase encoding genes fumA, fumB, fumC in an ammonium-tolerant escherichia coli BEW308 are inactivated, and then L-aspartase encoding and L-asparaginase encoding genes are inserted into the positions of the fumarase encoding fumAC genes, thereby obtaining the recombinant escherichia coli having no malic acid by product, less L-aspartic acid accumulated, and a major product L-asparagine. The invention also discloses a construction method and an application of the bacterial strain. The recombinant escherichia coli can realize constitutive high-activity expression of L-aspartase and L-asparaginase, and ultimately achieve transformation of fumaric acid into L-asparagine.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a strain for producing L-asparagine by transforming fumaric acid and its construction method and application. Background technique [0002] L-Asparagine is the hydroxyl amide compound of L-Aspartic acid, which has wide applications in medicine, food, light chemical industry and water environmental protection. Efficacy in treating skin diseases. In the food industry, as long as it is used as a nutritional supplement and an anti-alcohol poisoning agent, it can also be further derived as a flavoring agent. In the chemical industry, it is mainly used as a stabilizer for iron salts and a film on ceramic surfaces. In the environmental protection industry, it is an important raw material for water treatment membranes. [0003] At present, the production of L-asparagine is mainly made from L-aspartic acid through esterification and ammonolysis, but the yield of the p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P13/20C12R1/19
CPCC12N9/82C12N9/88C12N15/70C12P13/20C12Y305/01001C12Y402/01002C12Y403/01001C12N2800/101
Inventor马江锋姜岷董维亮章文明陈可泉吴昊
OwnerNANJING UNIV OF TECH