Synthesis method for 4-hydroxyisoleucine

A technology of hydroxyisoleucine and a synthesis method is applied in the field of compound biotechnology production, and can solve the problems of difficult preparation, many steps and high preparation cost

Active Publication Date: 2016-09-28
TIANJIN UNIV OF SCI & TECH
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The production methods of 4-hydroxyisoleucine include extraction method, chemical synthesis method, enzymatic method and biological method. At present, the technology of industrial production of 4-hydroxyisoleucine is relatively mature, but it is mainly extracted from heavy fenugreek. Its product separation and purification is difficult, difficult to prepare, low product purity, serious environmental pollution, high cost of mass production, and more configurations of 4-hydroxyisoleucine obtained by this method, but only (2S, 3R, 4S)-4 -Hydroxyisoleucine has the above-mentioned biological activity, so that the method has a low extraction rate (only 0.091-0.6%)
The total yield of this method is 39%, and the reaction conditions are harsh, there are many steps, and it is easy to cause environmental pollution, so it still stays in the laboratory stage

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Synthesis method for 4-hydroxyisoleucine
  • Synthesis method for 4-hydroxyisoleucine
  • Synthesis method for 4-hydroxyisoleucine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Construct strain E.coli BL21(DE3) / pETduet-ido-lgox and express L-isoleucine-4-hydroxylase and L-glutamic acid oxidase, using substrates L-glutamic acid and L-iso Enzymatic Synthesis of 4-Hydroxyisoleucine from Leucine

[0026] (1) Obtain ido and lgox nucleotide sequences

[0027] According to the nucleotide sequences of ido and lgox shown in Sequence Listing 1 and 2, the nucleotide sequences shown in Sequence Listing 3 and 4 were obtained by performing codon optimization on E.coli BL21(DE3) acid sequence. ido and lgox are exogenous genes, in order to increase their expression in the host E.coli BL21(DE3), it is necessary to optimize their codons to the most frequently used sequences in the host, wherein,

[0028] ido optimized nucleotide sequence for E.coli BL21(DE3), primers:

[0029] Upstream primer: 5'TAT GGATCC ATGAAAATGAGCGGTTTTAGCA 3'

[0030] Downstream primer: 5'CCC AAGCTT TTATTTGGTTTCTTTATAGCTAAAGGTC 3'

[0031] lgox optimized nucleotide sequence for E...

Embodiment 2

[0045] Embodiment 2 Enzyme Catalytic Synthesis of 4-Hydroxyisoleucine

[0046] Add the crude enzyme obtained in Example 1(4) into the prepared reaction buffer, the final concentration is 20g / L; catalyze the reaction at 30°C and 150rpm in a water bath shaker for 4h, centrifuge and take the supernatant to obtain the product 4-Hydroxyisoleucine. As detected by HPLC, after 4 hours of catalytic reaction, the conversion rates of L-glutamic acid and L-isoleucine were 91.2% and 93.5%, respectively.

[0047] The above reaction buffer preparation method: L-glutamic acid 20g / L, L-isoleucine 15g / L, Fe 2+ 20mmol / L, Vc 5mmol / L, 0.1mol / L sodium carbonate-sodium bicarbonate buffer solution (the configuration method is to dissolve 21.2g sodium carbonate and 67.2g sodium bicarbonate in water and dilute to 1L), pH 9.1.

Embodiment 3

[0048] Embodiment 3 enzymatic method synthesizes 4-hydroxyisoleucine

[0049] Add the crude enzyme obtained in Example 1(4) into the prepared reaction buffer, the final concentration is 30g / L; catalyze the reaction at 32°C and 150rpm in a water-bath shaker for 4h, centrifuge to take the supernatant, and obtain the product 4-Hydroxyisoleucine. As detected by HPLC, after 4 hours of catalytic reaction, the conversion rates of L-glutamic acid and L-isoleucine were 97.01% and 98.45%, respectively.

[0050] The above reaction buffer preparation method: L-glutamic acid 20g / L, L-isoleucine 15g / L, Fe 2+ 20mmol / L, Vc 5mmol / L, Hepes 50mmol / L, pH 7.0.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
boiling pointaaaaaaaaaa
densityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a synthesis method for 4-hydroxyisoleucine. The method comprises the following steps: firstly, constructing recombinant expression plasmids for expressing L-isoleucine-4-hydroxylase and L-glutamate oxidase simultaneously; adding two types of substrates including L-glutamic acid and L-isoleucine into a constructed catalytic reaction system; taking the substrates as precursors of a catalytic reaction and synthesizing the 4-hydroxyisoleucine. After the catalytic reaction is performed for 4h, the conversion rates of the L-glutamic acid and the L-isoleucine are 97.01 percent and 98.45 percent respectively. By replacing alpha-ketoglutaric acid with the L-glutamic acid and utilizing the L-glutamic acid as the precursor for synthesizing the 4-hydroxyisoleucine, the 4-hydroxyisoleucine can be efficiently produced, the production cost is low and industrial production is convenient to realize.

Description

technical field [0001] The invention relates to the field of compound biotechnology production, in particular to a method for synthesizing 4-hydroxyisoleucine. Background technique [0002] In the field of biotechnology, although the related cloning and expression technology using Escherichia coli as the host is very mature, the recombinant expression of heterologous proteins is still an important research content. In order to improve the solubility and expression of recombinant proteins, it takes a lot of time With a lot of laboratory work, the final success can only be achieved through repeated experiments and re-experimental efforts. [0003] 4-Hydroxyisoleucine (4-Hydroxyisoleucine, 4-HIL) is a kind of L-isoleucine hydroxylate mainly present in the seeds of fenugreek plants. The molecular formula of 4-HIL is C6H13NO3, the molecular weight is 147.17, the melting point is greater than 200°C, the boiling point is 332°C, and the density is 1.181g / cm3. Studies have shown th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N15/74C12N15/77C12N15/75C12N1/21C12P13/04C12R1/15C12R1/19C12R1/425C12R1/32C12R1/125C12R1/07C12R1/10C12R1/085
CPCC12N9/0022C12N9/0071C12N15/70C12N15/74C12N15/75C12N15/77C12N2800/101C12P13/04C12Y104/03011
Inventor谢希贤张成林陈宁麻杰刘涛徐庆阳
OwnerTIANJIN UNIV OF SCI & TECH