Application of Soybean myb Transcription Factor Gene to Enhance Soybean Isoflavone Biosynthesis

A technology of soybean isoflavones and transcription factors, applied in the field of genetic engineering, can solve problems such as inability to obtain results

Inactive Publication Date: 2019-09-24
JILIN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The metabolic pathway of isoflavones is catalyzed by multiple key enzymes, and regulating a certain key enzyme alone cannot obtain the expected results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Soybean myb Transcription Factor Gene to Enhance Soybean Isoflavone Biosynthesis
  • Application of Soybean myb Transcription Factor Gene to Enhance Soybean Isoflavone Biosynthesis
  • Application of Soybean myb Transcription Factor Gene to Enhance Soybean Isoflavone Biosynthesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1, the cloning of soybean GmMYB9 gene

[0026] RNAiso Plus (purchased from TaKaRa) was used to extract total RNA from 20-day embryos of soybean variety Williams 82, and the integrity of RNA was detected by 1% agarose electrophoresis. cDNA was synthesized according to Reverse Transcriptase M-MLV (RNase H - ) instructions. Primers were designed according to the full-length sequence of GmMYB9, and the primers were:

[0027] GmMYB9-F:AACAACATAGAGAGCCATAATACCC

[0028] GmMYB9-R: CATAGACTCCTCTTTCAAAACACCTC

[0029] Perform PCR amplification according to the reaction system in Table 1:

[0030] Table 1 PCR amplification reaction system

[0031]

[0032] The PCR reaction program was: 95°C for 4min; 30 cycles of 94°C for 30s, 57°C for 50s, and 72°C for 90s; 72°C for 10min. The GmMYB9 gene was obtained by PCR amplification, such as figure 1 As shown, it consists of 1188 base pairs, and the reading frame is from the 1st to the 1188th base at the 5' end, encodi...

Embodiment 2

[0033] Embodiment 2, expression of soybean GmMYB9 gene in yeast

[0034] Primers containing EcoR I and Sal I restriction sites were designed at the 5' end and 3' end of the gene, respectively, and the plasmid pMD18-T-GmMYB9 identified correctly by sequencing was used as a template for PCR amplification. pMD18-T was purchased from TaKaRa Corporation. Primers are as follows (restriction sites are underlined):

[0035]GmMYB9-HF: 5'- CCGGAATTC ATGGGAAGGAGTCCTTGC-3', EcoR I

[0036] GmMYB9-HR: 5'- ACGCGTCGAC CTACAGATACTGAATGTA-3', Sal I

[0037] After the amplified product was purified by an agarose gel DNA purification and recovery kit (purchased from BioTeke Company), it was digested with EcoRI and Sal I, and after recovery and purification, it was mixed with pGBKT7 ( purchased from clontech) carrier ligation. The ligated product was transformed into Escherichia coli (E.coli) DH5α, and after verification, it was transformed into yeast AH109 (purchased from clontech) for e...

Embodiment 3

[0040] Example 3. Research on subcellular localization of soybean GmMYB9 gene

[0041] The stop codon of GmMYB9 was removed, and the fusion gene of GmMYB9 and green fluorescent protein gene eGFP was constructed by overlapping extension PCR (SOE-PCR), and Xba I and SacI restriction sites were designed at the 5' and 3' ends respectively. Primers, using the correctly identified pMD18-T-GmMYB9 and peGFP-X1 as templates, and using O-F3 and O-R3, O-F4 and O-R4 as paired primers for common PCR amplification, PCR products were recovered and made Good mark. Primers are as follows (restriction sites are underlined):

[0042] GmMYB9-SOE-F(O-F3):5'- GCTCTAGA ATGGGAAGGAGTCCTTGC-3',Xba I

[0043] GmMYB9-SOE-R(O-R3):

[0044] 5'-CACCAT CAGATACTGAATGTACTT-3' (the wavy line represents

[0045] Linker between target gene and reporter gene)

[0046] eGFP-SOE-F(O-F4):

[0047] 5'-GTATCTG ATGGTGAGCAAGGGCGAG-3'

[0048] eGFP-SOE-R(O-R4):5'- CGAGCTC TTACTTGTACAGCTCGTC-3', SacI

[004...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of a soybean MYB transcription factor gene in improvement of soybean isoflavone biosynthesis and belongs to the technical field of genetic engineering. The GmMYB9 gene is 1188bp and encodes 395 amino acids; a yeast one-hybrid experiment result indicates that GmMYB9 has transcriptional activation activity, and a subcellular localization result proves that GmMYB9 is located in a cell nucleus; a real-time fluorescence quantification PCR (polymerase chain reaction) result shows that expression tendency of GmMYB9 in a soybean development process from immature embryos to mature seeds is consistent with accumulation tendency of isoflavone, and the expression quantity of GmMYB9 in a variety with high isoflavone content is higher than that of GmMYB9 in a variety with low isoflavone content; the isoflavone content of seeds and leaves of T2-generation transgenic soybeans with the transformed GmMYB9 gene is increased, therefore, the GmMYB9 gene participates in regulation of the soybean isoflavone biosynthesis and has great significance in cultivation of the soybean varieties with high isoflavone content.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and relates to the application of the soybean MYB transcription factor GmMYB9 gene to improve the biosynthesis of soybean isoflavones. Background technique [0002] Soybean is rich in protein and oil, and is an important grain and economic crop. Isoflavones in soybean can improve the ability of plants to defend against abiotic stress, and have many functions in human nutrition and health. Isoflavone synthesis pathway is a branch pathway of plant phenylpropanoid metabolism. Phenylpropanoid metabolism is ubiquitous in plants, but isoflavones are mainly synthesized in legumes, and its accumulation is determined by both genetic and environmental factors. [0003] The metabolic pathway of isoflavones is catalyzed by multiple key enzymes, and the expected results cannot be obtained by regulating a certain key enzyme alone. However, the MYB transcription factor gene can regulate the express...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H6/54
Inventor王庆钰赵明珠闫帆王英李景文王天亮郭文云申梓邑何禹璇程浩
OwnerJILIN UNIV