Elizabethkingia meningoseptica loop-mediated isothermal DNA amplification rapid detection kit and detection method
A constant-temperature gene amplification and detection kit technology, which is applied in the field of cationofDNA, can solve the problems of complex operation, limitation, and long time consumption, and achieve the effect of low equipment requirements, short detection time, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Establishment of a rapid detection kit and detection method for ring-mediated constant temperature gene amplification of Elizabeth bacteria meningeseptica
[0030] Step 1, design of primers and assembly of synthetic kits:
[0031] The primer sequences determined in this embodiment for detection are as follows:
[0032] Outer primer 1: GTAAAATCCTGAACGTAGAGAA,
[0033] Outer primer 2: GTTAGGATCAATGTGGAGATG,
[0034] Internal primer 1: ACCCACACTTACACCTAAAGCAG-GTCAATGCTTCATAAAGTATACGA,
[0035] Inner primer 2: GGACAGCAAGGCACTAAACCT-TGAGAACCATCCACATCG.
[0036] On this basis, the Elizabethan meningoseptica ring-mediated constant temperature gene amplification rapid detection kit is designed, which includes:
[0037] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;
[0038] (2) Reaction...
Embodiment 2
[0049] negative control
[0050] Step 1, design of primers and assembly of synthetic kits:
[0051] The sequence of primers used for detection determined in this embodiment is the same as that in Example 1.
[0052] On this basis, the Elizabethan meningoseptica ring-mediated constant temperature gene amplification rapid detection kit is designed, which includes:
[0053] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;
[0054] (2) Reaction solution 2: composed of 10 μmol / L outer primer 1 (F3), 10 μmol / L outer primer 2 (B3), 40 μmol / L inner primer 1 (FIP) and 40 μmol / L inner primer 2 (BIP);
[0055] (3) 8U / μL Bst DNA polymerase;
[0056] (4) Chromogen: 10wt% SYBR Green I fluorescent dye;
[0057] The reaction solution 1 in the above-mentioned loop-mediated constant temperature gene amplif...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
