Protein transduction peptide-paraoxonase 1 fusion protein and preparation method and application thereof

A technology of protein transduction peptide and fusion protein, which is applied in the field of fusion protein of protein transduction peptide and paraoxonase 1, and can solve the problems of reducing curative effect and the like

Inactive Publication Date: 2016-11-23
INST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, some proteins are degraded by proteases in the digestive tract, which reduces their efficacy, so it is necessary to develop such protein drugs for mucosal absorption

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein transduction peptide-paraoxonase 1 fusion protein and preparation method and application thereof
  • Protein transduction peptide-paraoxonase 1 fusion protein and preparation method and application thereof
  • Protein transduction peptide-paraoxonase 1 fusion protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Embodiment 1. Bombyx mori expression vector construction and silkworm expression

[0062] The artificially synthesized P11-PON1 fusion gene NCOI+PTD+PON1+XhoI sequence is as follows:

[0063] CCATGGGC TATGGTCGTAAAAAACGTCGCCAGCGTCGCCGTAtggcgaagctgattgcgctcaccctcttggggatgggactggcactcttcaggaaccaccagtcttcttaccaaacacgacttaatgctctccgagaggtacaacccgtagaacttcctaactgtaatttagttaaaggaatcgaaactggctctgaagac ttg gagatactgcctaatggactggctttcattagctctggattaaagtatcctggaataaagagcttcaaccccaacagtcctggaaaaatacttctgatggacctgaatgaagaagatccaacagtgttggaattggggatcactggaagtaaatttgatgtatcttcatttaaccctcatgggattagcacattcacagatgaagataatgccatgtacctcctggtggtgaaccatccagatgccaagtccacagtggagttgtttaaatttcaagaagaagaaaaatcgcttttgcatctaaaaaccatcagacataaacttctgcctaatttgaatgatattgttgctgtgggacctgagcacttttatggcacaaatgatcactattttcttgacccctactta caa tcctgggagatgtatttgggtttagcgtggtcgtatgttgtctactatagtccaagtgaagttcgagtggtggcagaaggatttgattttgctaatggaatcaacatttcacccgatggcaagtatgtctatatagctgagttgctggctcataagattcatgtgt...

Embodiment 2

[0067] Example 2 Identification of P11-PON1 fusion protein

[0068] Take 1 gram of dry insect body powder, dissolve it in 20ml of PBS solution, sonicate at 4°C for 20 minutes, centrifuge at 12,000r / min for 10 minutes, collect the supernatant, and use the BCA protein quantification kit to determine the total amount of silkworm protein; take 10 μl of the supernatant for SDS-PAGE For electrophoresis, prepare two 12% SDS-PAGE gels. After electrophoresis, one piece is stained with Coomassie brilliant blue for 1 hour, decolorized with glacial acetic acid overnight, and the Gel-pro gel imaging system is used to take pictures and scan to calculate the proportion of P11-PON1 fusion protein in the total Protein ratio, and finally calculate the net content of P11-PON1 fusion protein; another piece of gel is used for Western blot identification, 37 ° C after transfer, 5% skimmed milk blocking 2h, primary antibody (rabbit anti-human PON1 polyclonal antibody diluted 1:1000 ) at 4°C overnigh...

Embodiment 3

[0069] Example 3 The biological activity of P11-PON1 fusion protein

[0070] 3.1 Biological activity of P11-PON1 fusion protein on mice

[0071] Kunming mice were half male and half male, weighing 25±3 grams, fasted for 12 hours before the experiment to empty the stomach and intestines as much as possible, and drink water freely. The experimental groups were divided into intragastric administration group and rectal administration group, and the control group was intraperitoneally injected with 20 mg / kg body weight of dichlorvos. The experiment was repeated 3 times, with 6 rats in each group, half male and half male. Each mouse in the gavage group was directly given the expression supernatant (P11-PON1 fusion protein and PON1 protein (net content of PON1 protein 1 mg)) through the gavage needle; It tries to empty the feces in the rectum as much as possible, then probes into about 1.5cm with a gastric gavage needle, injects slowly, and withdraws the needle slowly after stoppin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to protein transduction peptide-paraoxonase 1 fusion protein and a preparation method and application thereof, in particular to a mammalian cell of protein transduction peptide-paraoxonase 1 (P11-PON1) fusion protein and a bombyx mori expressing method. The fusion protein has activity that the mucosa is absorbed into the body and can penetrate through the blood brain barrier. The fusion protein has a treatment effect on organic phosphorus pesticide poisoning and tumors, atherosclerosis, the coronary disease, diabetes mellitus type 2 and other diseases.

Description

technical field [0001] The present invention relates to the fusion protein of paraoxonase 1, in particular to the fusion protein of protein transduction peptide and paraoxonase 1 and the preparation and application of the protein. technical background [0002] Human serum paraoxonase 1 (paraoxonase 1, PON1) is a glycoprotein with a molecular weight of 45kDa synthesized and secreted by the liver, containing 355 amino acids, and mainly exists in blood, kidney, spleen, brain and other tissues and organs. PON1 is a calcium ion-dependent high-density lipoprotein-related lipase that can hydrolyze phosphate bonds and has a strong detoxification effect on organophosphorus compounds. Further studies have found that it plays an important role in regulating oxidative stress, lipid metabolism, and anti-inflammation, and is closely related to the occurrence of various diseases such as tumors, atherosclerosis, coronary heart disease, and type 2 diabetes. [0003] PON1 is a trace protein ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/16C12N15/62A61K38/46A61K47/48A61P39/02A61P35/00A61P9/10A61P3/10
Inventor赵宝全李前黄春倩孙曼霁
OwnerINST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A