Compositions and methods for preparing sequencing libraries

A technology for sequencing libraries and sequencing, applied in the field of compositions and methods for preparing sequencing libraries, capable of solving problems such as low coverage of genetic material, sample loss, and impact on sequencing data quality and output

Inactive Publication Date: 2016-12-07
MOLECULAR CLONING LAB MCLAB LLC
View PDF9 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The process of preparing a sequencing library can significantly affect the quality and output of sequencing data
Current methods of preparing DNA libraries for NGS are time consuming, prone to significant sample loss, and result in low coverage of the sequenced genetic material

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compositions and methods for preparing sequencing libraries
  • Compositions and methods for preparing sequencing libraries
  • Compositions and methods for preparing sequencing libraries

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0134] Preparation of topoisomerase-activated sequencing aptamers

[0135] Activated topoisomerase aptamers (TOPO aptamers) were prepared by hybridizing synthetic oligonucleotides (SEQ ID NO: 1 and 2), and (SEQ ID NO: 4 and 5). The first aptamer of the aptamer set was prepared by hybridizing a first oligonucleotide ACACTGTTTCACGACAGGTGTTGATCCCCTTATTCCGATAGTG (SEQ ID NO: 1 ) to a second oligonucleotide AAGGGCGATCAACACCTGTCGTGAAACAGTGT (SEQ ID NO: 2). The second aptamer of the aptamer set was prepared by hybridizing the third oligonucleotide AAGGGGTGACTGGAGTTCAGACGTGTGCTATC (SEQ ID NO:4) to the fourth oligonucleotide GATAGCACACGTCTGAACTCCAGTCACCCCTTATTCCGATAGTG (SEQ ID NO:5). Hybridization of the oligonucleotides provided a single topoisomerase recognition sequence / site CCCTT (SEQ ID NO: 11 ) for each aptamer. Oligonucleotides (10 μΜ) were hybridized in 10 mM Tris-HCl (pH 7.5), 160 mM NaCl and amplified in a thermal cycler with the following cycles: 98°C for 5 minutes, 85°C for...

Embodiment 2

[0139] Preparation of Sequencing Libraries Using Topoisomerase-Activated Adapters

[0140] To demonstrate the advantages of using TOPO adapters in preparing sequencing libraries for massively parallel sequencing, equal amounts of fragmented sample DNA were used to prepare sequencing libraries according to the topoisomerase-based method provided in this disclosure, and were compared with those using Illumina A ligase-only method to prepare libraries compared to the Illumina method that prepares sequencing libraries in parallel.

[0141] DNA sample preparation

[0142] Lambda DNA or human genomic DNA was sheared into mostly 350bp fragments using a Covaris M220 focused ultrasound generator. Incubate DNA samples (10-500 ng) at 20 °C in a solution containing 10 μl of 5X end repair buffer (1x concentration: 20 mM Tris-acetate, pH 7.9 at 25 °C, 50 mM potassium acetate, 10 mM magnesium acetate, 100 μg / ml bovine serum Protein (BSA)) was end-repaired for 15 minutes in a 50 μl reacti...

Embodiment 3

[0156] DNA sample preparation

[0157] Lambda DNA or human genomic DNA was sheared into mostly 350bp fragments using a Covaris M220 focused ultrasound generator. DNA samples (10-500 ng) were dephosphorylated at 50 °C in a 70 μl reaction mixture containing 10X end repair buffer and 5 μl alkaline phosphatase (shrimp alkaline phosphatase (5 units) or Antarctic phosphatase (25 units)) for 25 minutes. Alkaline phosphatase was heat inactivated at 75 °C for 10 min. Dephosphorylated sample DNA was end-repaired by adding an 8 μl mixture of end repair buffer, dNTPs and 2.5 μl (10 units) of end repair enzymes (Pfu DNA polymerase and / or KOD DNA polymerase) for 5 min at 72°C.

[0158] Topoisomerase-based preparation of sample DNA sequencing libraries

[0159] Dephosphorylation and end repair sample DNA with 2 μl activated topoisomerase aptamer prepared according to Example 1, 2 μl ligase (such as T4 DNA ligase or T7 DNA ligase), 1 μl ATP, 10X ligation in 100 μl reaction mix buffer ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Compositions comprising activated topoisomerase adaptors (TOPO-adaptors) and methods of using the activated TOPO-adaptors are provided for preparing a library of target DNA duplexes derived from sample polynucleotides (e.g., DNA, RNA) for the streamlined preparation of a large number of samples. Such libraries may be used for Next Generation Sequencing (NGS).

Description

[0001] Cross References to Related Applications [0002] This application claims the benefit of US Provisional Application No. 62 / 167,892, filed May 29, 2015, and US Provisional Application No. 62 / 218,906, filed September 15, 2015, which are hereby incorporated by reference in their entireties. [0003] sequence listing [0004] A Sequence Listing comprising SEQ ID NO: 1-35 is appended hereto. Each sequence provided in the Sequence Listing is hereby incorporated by reference in its entirety for all purposes. technical field [0005] Compositions and methods for preparing DNA libraries for sequencing by next generation sequencing methods are provided. Sequencing adapters are provided to improve the yield of library DNA and speed up the library preparation process. Background technique [0006] The advent of next-generation sequencing (NGS) methods has generated large amounts of nucleotide sequence information that can be used to provide sequence analysis in relation to gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C40B50/06C12Q1/68
CPCC12Q1/6869C40B50/06C12Q1/6806C12Q1/6874C12Q2521/501C12Q2521/519C12Q2521/525C12Q2525/155C12Q2525/191C12Q2525/301C12Q2525/313C12Q2535/122
Inventor郑建萍史长平沈丹N·唐
OwnerMOLECULAR CLONING LAB MCLAB LLC