Check patentability & draft patents in minutes with Patsnap Eureka AI!

Genetic transformation method of agrobacterium-mediated mustard

A genetic transformation method, Agrobacterium-mediated technology, applied in biochemical equipment and methods, botanical equipment and methods, introduction of foreign genetic material using vectors, etc., can solve the problems of low transformation rate, time-consuming and laborious, etc.

Inactive Publication Date: 2017-02-15
HUAZHONG AGRI UNIV
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current method has disadvantages such as low conversion rate, time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic transformation method of agrobacterium-mediated mustard
  • Genetic transformation method of agrobacterium-mediated mustard
  • Genetic transformation method of agrobacterium-mediated mustard

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1 of the present invention is illustrated by taking the genetic transformation of mustard hau CMS cytoplasmic male sterility gene as an example:

[0039] A method for genetic transformation of mustard mediated by Agrobacterium, comprising the steps of:

[0040] 1) Containing the construction of the target gene vector:

[0041] The CaMV35S promoter was connected to the pCAMBIA2300 vector, and the enzyme cutting sites used were HindIII and PstI;

[0042] PS: rfp288 73-288aa Construction of the vector: the signal peptide Rfp and rfp288 were combined by overlapping PCR technology 73-288aa The nucleotide sequences overlapped, and the enzyme cutting sites used include: PstI and BamHI.

[0043] Required primers include:

[0044] d-Rfp-L(PstI): AACTGCAGATGGTGTTGAGGACACAGAGAT;

[0045] d-Rfp-R: TCGTATCAAAGAGATTACCATTCTATCGCTGGTGAGACCAGA;

[0046] d-orf215-L:TCTGGTCTCACCAGCGATAGAATGGTAATCTCTTTGATACGA;

[0047] orf215R (BamHI): CGGGATCCTCAGTCTAGATAATGCCGGG.

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
conversion efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of transgenosis and particularly relates to a genetic transformation method of agrobacterium-mediated mustard. The specific method comprises the step of successfully obtaining transgenic positive seedlings through inducing culture callus via co-transformation by taking a mustard hypocotyl subjected to dark culture for 7 days as an explant and utilizing an agrobacterium infection hypocotyl carried with a target gene carrier, performing resistance screening, dedifferentiating and the like. The PCR authentication of the positive seedlings proves that a target gene is successfully transferred to a plant for expression. The invention establishes an efficient regeneration system of mustard, thereby providing a basis for the study on a mustard agrobacterium-mediated transgenic technology.

Description

technical field [0001] The invention belongs to the technical field of plant tissue culture and transgene, and in particular relates to an Agrobacterium-mediated genetic transformation method of mustard. [0002] technical background [0003] Mustard is an annual or perennial herb in the genus Brassicaceae. It is mainly grown as an oil crop and seasoning. Mustard contains abundant germplasm resources, which have very important scientific research value and economic use value. As fresh and processed vegetables, mustard greens mainly include: root mustard, stem mustard, leaf mustard and stalk mustard, which are mainly grown as vegetables in China. Oil crops are mainly seed mustard, which is currently widely planted in arid regions of India, Canada, Australia and other countries. [0004] Since the world's first genetically modified tobacco was successful in 1984, more and more crop genetically modified systems have been successfully established. Among Brassica crops, only t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82A01H5/00
CPCC12N15/8205
Inventor 衡双平魏超陈凤仪沈金雄傅廷栋涂金星马朝芝易斌文静李兴华
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More