O type foot and mouth disease virus-like particle and preparation method thereof and application
A foot-and-mouth disease virus and a technology for foot-and-mouth disease, applied in the field of agricultural science, animal husbandry and veterinary science, can solve the problems of high production cost, low VLPs yield, restricting the industrialization process, etc., and achieve the effect of improving assembly efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Construction of O-type foot-and-mouth disease virus-like particles
[0042](1) Construction of small ubiquitin-like modified protein fusion expression vectors pSMA and pSMK:
[0043] a. Using Saccharomyces cerevisiae genomic DNA as a template, using smt3F and smt3R as primers to amplify the smt3 gene, the primer sequences are as follows:
[0044] smt3F: 5'GCCATGGGTCATCACCATCATCATCATCACGGGTCGGACTCAGAAGTCAATCAA3',
[0045] smt3R: 5'GGATCCGAGACCTTAAGGTCTCCAACCTCCAATCTGTTCGCGGTG3',
[0046] b. After double digestion with NcoI and BamHI, insert the smt3 gene into the pET-28a vector treated with the same endonuclease, the resulting vector is pSMK, and replace the kanamycin resistance gene of pSMK with the ampicillin resistance gene , to obtain vector pSMA;
[0047] (2) Construction of recombinant expression vector of foot-and-mouth disease structural protein gene
[0048] According to the published sequence of O-type foot-and-mouth disease virus (GenBank accessi...
Embodiment 2
[0069] Example 2 Detection of immune efficacy of O-type foot-and-mouth disease virus-like particles
[0070] 13 5-week-old pigs were divided into 3 groups, the first group (3) was immunized with PBS as a control, the second group (5) was immunized with the VLPs protein containing optiVP3 prepared in Example 1, and the third group (5 rats) were immunized with the VLPs protein containing non-deleted VP3 prepared in Example 1. Before immunization, blood was collected from the jugular vein of all experimental pigs, blood was collected every week from the first week after immunization, the serum was separated and the antibody level was detected. After serial dilution, add foot-and-mouth disease type O virus antigen (diluted 1:20), and let stand overnight at 4°C. Transfer the antigen-antibody mixture to the ELISA plate coated with FMD O-type rabbit antibody, seal the plate, and incubate at 37°C for 60min. Wash with PBST three times, add foot-and-mouth disease type O guinea pig ant...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com