Genetically engineered bacterium with high-yield electroactivity and environmental stress tolerance

A technology of genetically engineered bacteria and genetically engineered strains, applied in the field of bioengineering, to achieve the effects of enhanced tolerance, high environmental stress tolerance, and high electrical activity

Active Publication Date: 2017-03-22
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the idea of ​​using this transcription factor to improve microbial electrogenic activity and environmental stress tolerance has not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium with high-yield electroactivity and environmental stress tolerance
  • Genetically engineered bacterium with high-yield electroactivity and environmental stress tolerance
  • Genetically engineered bacterium with high-yield electroactivity and environmental stress tolerance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] This example illustrates the construction of Pseudomonas aeruginosa ldhA gene knockout strain ldhA - . The specific process includes:

[0049] 1. Design upstream and downstream primers with restriction sites

[0050] ldhA-F: 5' TCCCCCCGGGCGGCATGGACGACTACCTGA 3'

[0051] ldhA-R: 5' ACATGCATGCTCAGGCCCGGACCCGAT 3'

[0052] GmR-F: 5'AACTGCAGATGAACCTGAATCGCCAGCG 3'

[0053] GmR-R: 5'AACTGCAGTAGGTGGCGGTACTTGGGTCG 3'

[0054] Using the wild-type Pseudomonas aeruginosa PAO1 genome as a template, amplify the 1485bp DNA fragment including ldhA (hereinafter referred to as ldhA); use the plasmid pBBR1MCS-5 as a template to amplify the Qingda resistance gene Gm r (850bp), the reaction system is shown in Table 1.

[0055] Table 1 PCR reaction system

[0056]

[0057] The PCR amplification conditions were: pre-denaturation at 94°C for 5 minutes; 30 cycles of 94°C for 30s, 64°C for 30s, and 72°C for 1 min; 72°C for 10 minutes.

[0058] 3. Gel recovery ldhA fragment, 16 ℃ and...

Embodiment 2

[0063] This example illustrates the construction of the recombinant expression plasmid pHERD20T-irrE. The specific process includes:

[0064] 1. Design and synthesize upstream and downstream primers with restriction sites (downstream primers have his tags)

[0065] Upstream primer irrE-F: 5'-CCGGAATTCGTGCCCAGTGCCAACGTCAG-3'

[0066] Downstream primer irrE-R: 5'-CCCAAGCTTGTGGTGGTGGTGGTGGTGCTGTGCAGCGTCCTGC-3'

[0067] 2. Use the genome of Deinococcus radiodurans R1 as a template to amplify the target fragment by PCR. The reaction system is shown in Table 2.

[0068] Table 2 PCR reaction system

[0069]

[0070] The PCR amplification conditions were: pre-denaturation at 94°C for 5 minutes; 30 cycles of 94°C for 30s, 58°C for 30s, and 72°C for 1 min; 72°C for 10 minutes.

[0071] The PCR product was detected by 1% agarose gel electrophoresis, and the fragment with a size of 982bp was recovered by cutting the gel, and double-digested by HindIII and EcoR I, purified, and the ...

Embodiment 3

[0073] This example illustrates the construction of genetically engineered strain ldhA - -irrE, the specific process includes:

[0074] The correctly sequenced pHERD20T-irrE was extracted again, introduced into the competent cells of Pseudomonas aeruginosa ldhA knockout strain by electric shock transformation, and then spread on LB plates containing 300 μg / mL carbenicillin for static culture at 37°C overnight. Pick positive transformants for gene level verification (PCR and double enzyme digestion), select transformants with correct gene level verification to collect bacteria, obtain protein samples after ultrasonic disruption and His-tag protein purification, and add protein loading buffer for further analysis. SDS-PAGE electrophoresis for protein level verification (eg Figure 4 shown), and it was verified that the genetically engineered strain ldhA of Pseudomonas aeruginosa was - -irrE.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a genetically engineered bacterium with high-yield electroactivity and environmental stress tolerance. The lactic dehydrogenase gene ldhA in a pseudomonas aeruginosa PAO1 genome is knocked out, and the PAOl knockout strain is obtained; then a global regulatory factor IrrE of the deinococcus radiodurans is guided into the ldhA-, and the genetic engineering strain ldhA--irrE is obtained. After the thallus treated through a chemical agent is inoculated to a microbial fuel cell, the generated voltage and power density are improved by 46.76%-53.33% than those of the wild type strain, the time for stabilizing a system is shortened by 28.57%, the internal resistance of the system is reduced by 12.66%, the voltage under polyethylene glycol treatment is 543, the power density is 207, the stabilizing time is 130 h, the internal resistance reaches 420.32, and the survival rate of the engineered strain under the hunger condition, the high-acid-base condition and high-salt condition are improved by one time than those of the wild type strain.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to the construction and application of a genetically engineered bacterium for high electrical activity and environmental stress tolerance of microbial fuel cells. Background technique [0002] With the aggravation of problems such as energy shortage and environmental degradation, the development and utilization of waste biomass energy has received widespread attention. Microbial fuel cells (MFCs) are new devices that use microorganisms as anode catalysts to directly convert chemical energy stored in organic matter (including organic pollutants in wastewater) into electrical energy, with high energy conversion rates and diverse fuel sources. , mild reaction conditions, economical and non-polluting advantages. In 2004, the research group of Professor Logan of Pennsylvania State University reported the simultaneous application of MFCs in power generation and sewage treatment. Si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/78C12N15/66H01M8/16C12R1/385
CPCC07K14/195C12N9/0006C12N15/66C12N15/78H01M8/16Y02E60/50
Inventor骆健美王敏王婷婷李晓申雁冰郑宇
OwnerTIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY