Genetically engineered bacterium with high-yield electroactivity and environmental stress tolerance
A technology of genetically engineered bacteria and genetically engineered strains, applied in the field of bioengineering, to achieve the effects of enhanced tolerance, high environmental stress tolerance, and high electrical activity
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] This example illustrates the construction of Pseudomonas aeruginosa ldhA gene knockout strain ldhA - . The specific process includes:
[0049] 1. Design upstream and downstream primers with restriction sites
[0050] ldhA-F: 5' TCCCCCCGGGCGGCATGGACGACTACCTGA 3'
[0051] ldhA-R: 5' ACATGCATGCTCAGGCCCGGACCCGAT 3'
[0052] GmR-F: 5'AACTGCAGATGAACCTGAATCGCCAGCG 3'
[0053] GmR-R: 5'AACTGCAGTAGGTGGCGGTACTTGGGTCG 3'
[0054] Using the wild-type Pseudomonas aeruginosa PAO1 genome as a template, amplify the 1485bp DNA fragment including ldhA (hereinafter referred to as ldhA); use the plasmid pBBR1MCS-5 as a template to amplify the Qingda resistance gene Gm r (850bp), the reaction system is shown in Table 1.
[0055] Table 1 PCR reaction system
[0056]
[0057] The PCR amplification conditions were: pre-denaturation at 94°C for 5 minutes; 30 cycles of 94°C for 30s, 64°C for 30s, and 72°C for 1 min; 72°C for 10 minutes.
[0058] 3. Gel recovery ldhA fragment, 16 ℃ and...
Embodiment 2
[0063] This example illustrates the construction of the recombinant expression plasmid pHERD20T-irrE. The specific process includes:
[0064] 1. Design and synthesize upstream and downstream primers with restriction sites (downstream primers have his tags)
[0065] Upstream primer irrE-F: 5'-CCGGAATTCGTGCCCAGTGCCAACGTCAG-3'
[0066] Downstream primer irrE-R: 5'-CCCAAGCTTGTGGTGGTGGTGGTGGTGCTGTGCAGCGTCCTGC-3'
[0067] 2. Use the genome of Deinococcus radiodurans R1 as a template to amplify the target fragment by PCR. The reaction system is shown in Table 2.
[0068] Table 2 PCR reaction system
[0069]
[0070] The PCR amplification conditions were: pre-denaturation at 94°C for 5 minutes; 30 cycles of 94°C for 30s, 58°C for 30s, and 72°C for 1 min; 72°C for 10 minutes.
[0071] The PCR product was detected by 1% agarose gel electrophoresis, and the fragment with a size of 982bp was recovered by cutting the gel, and double-digested by HindIII and EcoR I, purified, and the ...
Embodiment 3
[0073] This example illustrates the construction of genetically engineered strain ldhA - -irrE, the specific process includes:
[0074] The correctly sequenced pHERD20T-irrE was extracted again, introduced into the competent cells of Pseudomonas aeruginosa ldhA knockout strain by electric shock transformation, and then spread on LB plates containing 300 μg / mL carbenicillin for static culture at 37°C overnight. Pick positive transformants for gene level verification (PCR and double enzyme digestion), select transformants with correct gene level verification to collect bacteria, obtain protein samples after ultrasonic disruption and His-tag protein purification, and add protein loading buffer for further analysis. SDS-PAGE electrophoresis for protein level verification (eg Figure 4 shown), and it was verified that the genetically engineered strain ldhA of Pseudomonas aeruginosa was - -irrE.
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



