73 results about "Shewanella putrefaciens" patented technology

The invention provides a Bacillus coagulans HEW-B379 with a probiotic effect. The above strain is named as HEW-B379, and the preservation number of the strain is CGMCC No.12553. The Bacillus coagulans HEW-B379 has a substantial probiotic property, and can effectively inhibit growth breeding of enteropathogenic Escherichia coli, Staphylococcus aureus, Salmonella typhi, salmonella, Shigella, Proteus species, Shewanella putrefaciens and Pseudomonas aeruginosa. The Bacillus coagulans HEW-B379 has strong stress resistance, can resist high temperature and simulated gastric juice and simulate bile salt environment, can keep the survival rate of 99-100%, and can effectively adjust microbial balance of animal intestinal tracts, inhibit growth of harmful microbes, promote nutrition absorption of animals, improve the conversion rate of a feed and improve the productivity of the animals.

The invention provides a method for repairing cadmium-polluted soil by the combination of microorganisms and plants. The method comprises the following steps: uniformly scattering ryegrass seeds into cadmium-containing soil and watering to keep a moist soil condition; and after 10-20 days, adding a microorganism compound bacterial agent into ryegrass root soil when the plants sprout and grow, so as to remove cadmium in the soil by the combination of the absorption effect on the cadmium of ryegrass and the strengthening effect of the microorganism compound bacterial agent, wherein the microorganism compound bacterial agent is prepared by mixing Bacillus cereus, Bacillus subtilis and Shewanella in a wet bacterium mass ratio of (1-10) to 1 to 1. According to the method, the operation is convenient, the cost is low, the management is easy, secondary pollution cannot be caused, and the application prospect is wide.

The present disclosure relates to isolation, identification and application of Shewanella putrefaciens strain LH4:18 that grows, under denitrifying anaerobic conditions, on crude oil as the sole carbon source. This organism assists in oil release from substrate in reservoir simulations when grown on either lactate or peptone as a carbon source. Shewanella putrefaciens strain LH4:18 can be used alone or in concert with other microorganisms to improve oil recovery.

The present invention relates to one new kind of Shewanella decolorationis and is Shewanella decolorationis CCTCC M 203093. By means of the separation and purification of the active sludge in the waste water treating system of Guangzhou printing and dyeing plant, one new kind of Shewanella decolorationis is obtained. The Shewanella decolorationis can degrade dye in waste printing and dyeing water effectively, raise waste water treating efficiency and improve water ecological environment quality.

The invention discloses shewanella spp and application thereof in a microbial fuel cell and relates to the technical field of biology. The shewanella spp is shewanella xiamenensis sp.nov.S4 preserved in the 'China Center for Type Culture Collection' in January, 2009 with the preservation number of CCTCC M 209017. The shewanella spp has the characteristics of negative Gram stain, rod-shaped and straight thallus, two circular ends, diameter of 0.3 to 1.2mu m, length of 2.5 to 5.8mu m, single or paired existence and short-chain arrangement, single flagella on the thallus, mobility, capability of producing electricity in a seawater environment and higher electricity production activity and is obtained by separating marine sediments near the sea.

The invention discloses a Shewanella haliotis strain and its application in bioelectricity generation. The Shewanella haliotis strain is Shewanella haliotis Z4, is preserved by China Center for Type Culture Collection called CCTCC for short, has a preservation number of CCTCC NO:M2012444, and is preserved on Nov., 6, 2012. The strain can transmit electrons to an extracellular electron acceptor under an anaerobic condition, and can degrade organic matters and generate electric energy when the strain is inoculated to a microbial fuel cell. The Shewanella haliotis Z4 has a very strong electrochemical activity, and can generate electricity by utilizing a plurality of types of organic matters as a sole carbon source. The Shewanella haliotis Z4 has a very good application prospect in polluted environment restoration and biological energy recovery based on the above characteristics.

The present disclosure relates to isolation, identification and application of Shewanella putrefaciens strain LH4:18 that grows, under denitrifying anaerobic conditions, on crude oil as the sole carbon source. This organism assists in oil release from substrate in reservoir simulations when grown on either lactate or peptone as a carbon source. Shewanella putrefaciens strain LH4:18 can be used alone or in concert with other microorganisms to improve oil recovery.

The invention discloses a high-electricity-generation shewanella bacterium. The high-electricity-generation shewanella bacterium is named as Shewanella oneidensis; the high-electricity-generation shewanella bacterium has been preserved in the typical culture preservation center of China; the preservation serial number of the high-electricity-generation shewanella bacterium is CCTCC No: M2014340; the preservation date is July 16, 2014. The invention further discloses application of the high-electricity-generation shewanella bacterium to electricity generation. By means of the high-electricity-generation shewanella bacterium and the application of the high-electricity-generation shewanella bacterium, a survey direction is provided for the electricity-generation capacity of the shewanella bacterium in an MFC. According to the high-electricity-generation shewanella bacterium, when 20mM sodium lactate serves as an electron donor, the maximum output voltage is as high as 449 mV and is improved by 18.2% compared with that ofan initial bacterial strain MR-1, and the maximum output power density is 160 mW / m<2> and is improved by 82.6% compared with that of the initial bacterial strain MR-1.

The invention discloses a shewanella putrefaciens CR7 strain of which the preservation number is CGMCC NO.6192. The strain is separated out from cattle manure compost which is kept in a low-temperature environment for a long time; and a microbial inoculum prepared from the strain can be applied to livestock and poultry manure compost such as cattle manure and the like in winter, and has the effects of quickly starting compost fermentation, increasing compost fermentation temperature, shortening compost fermentation period and reducing nitrogen element loss. The microbial inoculum prepared from the strain is used for producing an organic fertilizer in winter, and can omit the heating procedure in the early stage of the composting of the organic fertilizer, shorten the production period of the organic fertilizer, increase the yield and lower the production cost.

The invention discloses arginine decarboxylase and application thereof and belongs to the technical field of biological engineering. Shewanella putrefaciens is cloned by adopting genome database mining and homologous sequence alignment and other virtual screening means and combining with a molecular biological means to obtain an arginine decarboxylase gene. The molecular biological means, process optimization and the like are adopted, the enzyme production capacity of arginine decarboxylase production strains is improved, and a platform for efficiently producing gamatine through biological catalysis is established by optimizing a catalytic system. Crude enzyme liquid obtained through fermentation is purified and then is converted, a reaction system is clear in composition, and extraction and purification of follow-up products are promoted. Under the condition of 37 DEG C, the decarboxylase has high activity, meanwhile is beneficial to the growth of escherichia coli of host cells, and at the temperature, the reaction speed is improved greatly, a conversion period should be 24 hours, the gamatine yield can be up to 61-71 g / L, and the conversion rate can be up to 68-82%.

The invention provides Shewanella putrefaciens capable of effectively degrading acetonitrile and application of Shewanella putrefaciens. The collection number of Shewanella putrefaciens is CGMCC No.10148. The Shewanella putrefaciens can be used for treating petrochemical enterprise sewage water having low acetonitrile concentration, and rivers, lakes and seas polluted by the petrochemical enterprise sewage water, is high in adaptability to the petrochemical enterprise sewage water, and high in biostability, and can be used for effectively removing the low-concentration acetonitrile in the petrochemical enterprise sewage water.

The invention relates to the technical field of bio-energy and discloses a recombinant yeast strain and a microbial mixed bacteria electricity generation method. According to the recombinant yeast strain disclosed by the invention, genes PDC1, PDC5, PDC6, ADHI and ADH4 are knocked-out, and genes LDH, XR, XDH and XKS are inserted. Meanwhile, a yeast-Shewanella mixed bacteria system taking glucose and xylose as a carbon source is constructed, and by modifying brewer's yeasts, the glucose and xylose can be metabolized to produce lactic acid, and the carbon source and electron donors are providedfor shewanella in the MFC, so that available carbon source spectrums of the shewanella are increased, and the recombinant yeast strain has excellent performance on the electrochemical effect and laysa foundation for researching biomass by human beings and identifying new energy conversion manners.

The invention discloses an iron humate-microbe composite soil pollution repairing agent and a preparation method thereof. The composite repairing agent is composed of iron humate and humus reducing bacterium, wherein the humus reducing bacterium is shewanella putrefaciens or South Korea comamonas; each millimeter of composite repairing agent comprises 0.002 to 0.01 gram of iron humate, the number of humus reducing bacterium in each millimeter of composite repairing agent is more than 10<8>CFU; the iron humate is a complex prepared from humic acid and Fe(SO4).7H2O; the preparation method of the composite repairing agent comprises the following steps: extracting humic acid, preparing iron humate, culturing bacterium strains in a shake flask, carrying out fermentation to prepare inoculant, and mixing to prepare the repairing agent. Compared with the prior art, the provided repairing agent can be used to repair soil polluted by organic compounds, and has the advantages of good repairing effect, quick repairing speed, low production cost, simple and convenient preparation method, and easiness for large scale production.

The invention discloses a special black pine rejuvenation matrix which comprises raw materials including, by weight, 500 parts of fermented materials, 50 parts of pine leaf soil and 1 part of additives. The fermented materials, the pine leaf soil and the additives are uniformly mixed into the rejuvenation matrix. The fermented materials include 1000 parts of animal manure, 72 parts of fallen leaves, 0.1 part of zymophyte, 0.15 part of functional bacteria and 2.25 parts of additives. The zymophyte is EM (effective microorganism) bacteria, and the functional bacteria include geotrichum, Xiamen pseudomonas, soil heterotrophic shewanella, nitrogen-fixing bacteria and bacillus subtilis powder with the weight ratio of 1:1:2:1:1. According to the special black pine rejuvenation matrix, the structure of the soil can be improved, nutrient elements such as manganese, zinc, magnesium and potassium in the soil are remarkably increased, healthy growth of a root system is promoted, roots in the root system can be increased into hundreds of roots, the nutrient and water absorption capacity of black pines is greatly increased, the number of mycetes on the roots on the periphery of the black pine root system is remarkably increased, the dead-arm morbidity of the black pines is reduced from original 100% to 37.8%, and disease resistance is remarkably enhanced.

The invention discloses a shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and a construction method of the genetic engineering strain. According to the method,a Shewanella loihica mutant strain with a deep red phenotype is obtained by random insertion mutation of a transposon. Genetic identification and genetic complementation experiments confirm that a ypiD gene is inactivated by insertional mutation and accumulation of extracellular red matter is caused. The red substance is identified as hemoglobin by mass spectrometry, and then the ypiD gene is knocked out by homologous recombination, so that the shewanella loihica genetic engineering strain ypjD-knockout PV-4 capable of producing high-yield hemoglobin is obtained, the strain can secrete a large amount of hemoglobin extracellularly, and the biomass (OD600) reaches 2.4-2.6 under shake flask culture conditions, and the hemoglobin production is 90-120 mg / L, and great application value is provided.

The invention discloses a bacterial strain capable of resisting various aquaculture pathogenic bacteria and application thereof. The antagonistic bacterium is Bacillus amyloliquefaciens InAD-160, andthe microbial collection number is CGMCC No.14030. The Bacillus amyloliquefaciens InAD-160 is obtained by separating deep seawater of the Indian Ocean, can inhibit growth of various aquaculture pathogenic bacteria like Edwardsiella tarda, Aeromonas hydrophila, Shewanella putrefaciens and Vibrio vulnificus and can be used for preventing and controlling aquaculture diseases caused by the same. The Bacillus amyloliquefaciens InAD-160 obtained from deep sea is a biological prevention and control potential strain which is high in prevention and control efficiency and wide in prevention and controlrange and has great application and development prospect.

The invention discloses an algicidal Shewanella and application thereof in controlling blue algae water bloom. The Shewanella sp. Lzh-2 (CGMCC No.6549) with significant algae-lysed activity is isolated from Tai Hu lake water, and effective algicidal components hexahydro-pyrrolo[1,2-A]pyrazine-1,4-dione and indoline-2,3-dione are isolated, purified and identified from the metabolites of the Shewanella, wherein hexahydro-pyrrolo[1,2-A]pyrazine-1,4-dione has median lethal dose LD50 to Microcystis aeruginosa 9110 of 5.7 Mug / mL and has no lethal effect to Synechococcus BN60, and indoline-2,3-dione has median lethal doses to Microcystis aeruginosa 9110 and Synechococcus BN60 of 12.5 Mug / mL and 34.2 Mug / mL respectively. The Shewanella sp. Lzh-2 can be used for developing and producing novel biological algicides and ultimately used for controlling lake blue algae bloom.

The present invention relates to a biological method for preparing a ferrite-bismuth ferrite composite fluorescent material. The biological method comprises three steps of: step I: in a tryptone soy broth culture medium, respectively culturing 30 g / L shewanella putrefaciens MR-1 and 30 g / L iron-reducing bacteria CN-32; step II: using a peptization reflow technique to prepare transition metal single-doped iron oxide hydroxide; and step III: under an aerobic condition at the room temperature, adding the single-doped iron oxide hydroxide and bismuth ferrite respectively into the shewanella putrefaciens MR-1 and the iron reduction bacteria CN-32, standing and layering to obtain the ferrite-bismuth ferrite nano composite fluorescent material respectively prepared from the shewanella putrefaciens MR-1 and the iron-reducing bacteria CN-32. Compared with the current conditions, the biological method for preparing the ferrite-bismuth ferrite composite fluorescent material has the advantages of a low price, a simple process, less pollution, and a high recovery rate. The ferrite-bismuth ferrite composite fluorescent material powder obtained by the method is high in purity, complete in topography, and uniform in thickness, has good fluorescent properties and can be applied to the fields of magnetic resonance imaging, targeting drug delivery, magnetic hyperthermia, and the like.

The invention provides shewanella piezotolerans WP3 genetic engineering bacteria for producing eicosapentaenoic acid (EPA) in high yield. When the strain is compared with wild WPS, the Fis type transcription factor swp3548 which is closely positioned on the upstream of a pfa gene for EPA synthesis is deleted, so the transcription of genes required by EPA synthesis is increased by 3 to 12 times respectively, and the yield of EPA under each condition is improved by about 50 to 60 percent.

The invention belongs to the field of bioengineering, and relates to a shewanella putrefaciens phage isolated strain and application thereof. The shewanella putrefaciens phage isolated strain is shewanella putrefaciens phage SppYZU05 with the preservation number being CCTCC NO:M2016717. The invention also discloses bacteria inhibition application of the shewanella putrefaciens phage SppYZU05 as afood additive composition or a biological fresh-keeping agent in food production and storage, particularly, spoilage of fresh water or sea water products in cold chain circulation caused by shewanellaputrefaciens phage multiplication can be inhibited, and the product shelf life is prolonged.

The invention discloses a protoporphyrin PPIX-high-yielding shewanella genetic engineering bacterium and a construction method thereof. Suicide-type knockout plasmids p[delta]hemH1 and p[delta]hemH2 are constructed respectively. The suicide plasmids enter host shewanella by a conjugation way, and ferrous chelatase genes hemH1 and hemH2 of shewanella are subjected to double knockout by a homologousrecombination way; meanwhile, chlorhematin is added by an exogenous way to maintain the growth of the engineering bacterium, a large amount of protoporphyrin PPIX is accumulated and released to the outside of cells.

The invention discloses a low-temperature-resistant composite microbial agent used for treating contaminated water, and a preparation method and application thereof. The microbial agent is composed of Shewanella putrefaciens liquid and Pesudomonas testosterone liquid in a volume ratio of (1-2): (1-2). The low-temperature-resistant composite microbial agent has strong adaptability to environments, particularly has low temperature resistance and can normally grow and metabolize in a low-temperature environment. Environment-friendly microbes are employed to strengthen the self-cleaning function of a water body, digest pollutants in river water and organic matters in sludge at river bottom and to prevent secondary pollution of the water body. In use, the composite microbial agent is directly added without complex engineering process, so the composite microbial agent is convenient to use. The composite microbial agent can effectively reduce the contents of COD and ammonia nitrogen in sewage under a low temperature condition, and removal efficiency of the composite microbial agent is obviously better than removal efficiency of a single microbial strain.

This invention relates to a microbial agent. The microbial agent is characterized by comprising functional bacteria and a protective bacterium, wherein the functional bacteria are composed of shewanella putrefaciens, geobacter metallireducens, trichoderma viride and trichoderma harzianum and the protective bacterium is bacillus subtilis. The invention also relates to a method of improving soil quality. The preparation method comprises the following steps: (1) mixing the functional bacteria, the protective bacterium and bioactive substances in proportion to obtain a composite bacterial agent; and (2) fixing the composite bacterial agent obtained in the step (1) on biochar. The microbial agent prepared by the invention has very excellent effect in improving the content of soil organic matters, is simple in method, low in cost and free from secondary pollution, can synergistically degrade soil organic matter pollution, and has broad market value.

The invention discloses a biological dilution technique for organic sewage. The organic sewage with a higher chemical oxygen consumption concentration content and a higher biochemical oxygen demand concentration content and city organic sewage with a higher chemical oxygen consumption concentration content and a lower biochemical oxygen demand concentration content are mixed and uniformly stirred so that the chemical oxygen consumption of mixed organic sewage is 7000ml / L and the biochemical oxygen demand is 8000ml / L, and shewanella putrefaciens is added for culture. Through the adoption of the biological dilution technique disclosed by the invention, the chemical oxygen consumption concentration content and the biochemical oxygen demand concentration content in the organic sewage can be effectively reduced, and the shewanella putrefaciens is used for deep reduction, so that the operation is simple and convenient, and the effect is good.

The invention relates to a composite microbial agent. The agent is characterized by being prepared from the following microorganisms of Shewanella putrefaciens, Geobacter metallireducens, Shewanella alga,Methanococcus thermolithotrophicus,Brocadia anammoxidans and Bacillus subtilis, preferably, the mass raatio of the Shewanella putrefaciens to the Geobacter metallireducens to the Shewanella alga to the Methanococcus thermolithotrophicus to the Brocadia anammoxidans to the Bacillus subtilis is A:B:C:D:E:F, A is selected from the numbers of 1-3,B is selected from the numbers of 3-5, C is selected from the numbers 1-3, D is selected from the numbers of 2-4, E is selected from the numbers of 1-3, and F is selected from the numbers of 3-5; a preparation method and application thereof are also provided. The microbial agent has very excellent effects on repairing organic mattercontamination, and has a simple preparation method, low cost, no secondary pollutionand a broad market value.

The invention discloses a plasmid carrier construction method applied to Shewanella, and relates to Shewanella xiamenensis BC01 with a collection number of CGMCC No.11687. The method comprises the following steps: extracting a plasmid by the Shewanella xiamenensis BC01, purifying to obtain pSXM33, submitting the pSXM33 to inspection and sequencing; comparing obtained sequence information with NCBI database information, determining a distribution condition of an open reading frame on the pSXM33 plasmid, and drawing a map of the plasmid; intercepting a fragment with a duplication original part from the pSXM33 by a genetic engineering means, and connecting the intercepted fragment with a resistance and duplication origin fragment of a pET28a plasma to construct two plasmids, namely, pETSXM1 and pETSXM2. As proved, the pETSXM1 and the pETSXM2 can pass through escherichia coli and Shewanella MR-1.

The invention discloses a method for producing smelly white gourds by artificial inoculation fermentation, belonging to the technical field of transforming the industrial production of the traditional fermented food by adopting the modern controlled fermentation technology. The method comprises the following specific steps: liquid white gourds fermentation medium containing 2.0% of black bean sauce and 1.0% of sodium chloride is inoculated with one or more than one of bacillus pumilus, shewanella putrefaciens, hansenulaanomala, saccharomyces cerevisiae, lactobacillus plantarum and corynebacterium minutissimum according to the inoculum concentration of 0.5%-5.0% respectively; after fermentation for 10-15 days at the temperature of 20-40 DEG C, white gourd pieces which can be covered by fermentation fluid are thrown into the fermentation system to continue the fermentation for 10-15 days at the temperature of 20-40 DEG C, thereby forming the smelly white gourds. Compared with the traditional method for producing the smelly white gourds by natural fermentation, the method has the advantages that the fermentation period is short, the reproduction of harmful microorganism is reduced, the method is favourable for controlling the content of nitrite and the like; meanwhile, the quality of the product is stable, thereby being feasible for large-scale production.

The invention discloses a method for detecting a sea cucumber pathogenic bacterium, namely shewanella smarisflavi. The sequences of a probe SM1 and a probe SM2 for detection are as follows: SM1(5'-3'): CTTCTCGGATGTCGAGTTCCACTTCGA; and SM2(5'-3'): TCTGAAAAGCTACAGTTAACCATTCGTCGT. The method comprises the following steps: modifying the probes with amino, preparing gene chips, extracting DNA (Deoxyribonucleic Acid) of a sample to be detected, performing PCR (Polymerase Chain Reaction) amplification, performing fluorescence labeling, hybridizing with the gene chips, and detecting results by using a scanner. The method has the advantages that the sea cucumber pathogenic bacterium, namely shewanella smarisflavi can be rapidly and effectively detected, characteristics of being relatively good in specificity and sensitivity can be achieved, the capability of evaluating environments of sea cucumber cultivation areas and detecting the living body pathogenic bacterium, namely shewanella smarisflavi, the detection time can be greatly shortened, and occurrence and spreading of 'skin fester' can be effectively prevented.