Shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and construction method of genetic engineering strain
A technology of W. reuyi and genetically engineered bacteria, applied in the field of genetic engineering, can solve the problems of unsuitability for mass production, no engineering application, low yield and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Screening of Transposon Random Insertion Mutants
[0032] Loihiwanella (S.loihica) PV-4 was originally isolated from an iron-rich microbial mat next to the Raleigh submarine crater in Hawaii (about 1325 meters above sea level), and is Gram-negative Bacteria, belonging to the subgroup of the phylum Gamma-Proteobacteria, with facultative anaerobic properties. Zhou Zhong's laboratory has sequenced and annotated its whole genome, and conducted microbial classification and physiological and biochemical analysis, thus finding that, unlike other Shewanella bacteria, S.loihica PV-4, when using lactate as an electron donor, However, DMSO and thiosulfate cannot be used as electron acceptors.
[0033] The strain is currently difficult to carry out genetic manipulation, and the applicant has carried out genetic modification on it to make it easier to carry out genetic manipulation. The specific method is as follows:
[0034] The wild-type Loihiwanella (S.loihica) PV-4 ...
Embodiment 2
[0038] Example 2: Construction of ypjD gene knockout suicide plasmid
[0039] The upstream and downstream fragments of the ypjD gene were connected and introduced into the multiple cloning site of the recombination-integrated suicide plasmid pDS3.0 to obtain the suicide knockout plasmid p△ypjD containing the ypjD gene. The specific operation is as follows:
[0040] According to the whole genome sequence (GCA_000016065.1) of S. loihica PV-4 in the GenBank database, primers for knocking out ypjD were designed respectively. The primer sequences are as follows:
[0041] ypjD-sacI-3o:AGAGCTCctgggctcaggctcttg
[0042] ypjD-sacI-3i:agagacgacctaagccagtcttcttgtggtcatcgacctg
[0043] ypjD-sacI-5i:gactggcttaggtcgtctctacgctaaattccgcacactt
[0044] ypjD-sacI-5o:AGAGCTCatccatgatagagagcagca
[0045] PCR system: 25 μl of 2×MIX, 22 μl of deionized water, 1 μl of F primer, 1 μl of R primer, and 1 μl of DNA template.
[0046] PCR reaction conditions: 95°C for 5 minutes; 95°C for 30 seconds,...
Embodiment 3
[0051] Example 3: Construction of Gene Knockout Engineering Strain PV-4ΔypjD
[0052] First, the constructed gene knockout suicide plasmid p△ypjD was transferred into the auxotrophic strain E.coliWM3064. The suicide plasmid contained the R6K replicon, which could replicate in the bacteria containing the t protein, while in the strain without the t protein cannot replicate, so when the auxotrophic strain E.coli WM3064 containing the suicide knockout plasmid p△ypjD enters the host strain S.loihica PV-4 (genetic modification has been carried out with reference to the method described in Example 1) by conjugation, then Unable to replicate in this strain, it is therefore integrated into the homologous sequence in the genome. Since the integrated single-crossover strain contains a gentamicin-resistant gene and a sucrose-sensitive gene sacB, it can be expressed in 15 μg / ml Gentamicin was grown on an LB medium plate to obtain a single-crossover transformant in which the suicide plasmi...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com