Shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and construction method of genetic engineering strain

A technology of W. reuyi and genetically engineered bacteria, applied in the field of genetic engineering, can solve the problems of unsuitability for mass production, no engineering application, low yield and the like

Active Publication Date: 2019-04-12
INST OF AQUATIC LIFE ACAD SINICA
View PDF9 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low output, it is not suitable for mass production, and there is still no engineering application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and construction method of genetic engineering strain
  • Shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and construction method of genetic engineering strain
  • Shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and construction method of genetic engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Screening of Transposon Random Insertion Mutants

[0032] Loihiwanella (S.loihica) PV-4 was originally isolated from an iron-rich microbial mat next to the Raleigh submarine crater in Hawaii (about 1325 meters above sea level), and is Gram-negative Bacteria, belonging to the subgroup of the phylum Gamma-Proteobacteria, with facultative anaerobic properties. Zhou Zhong's laboratory has sequenced and annotated its whole genome, and conducted microbial classification and physiological and biochemical analysis, thus finding that, unlike other Shewanella bacteria, S.loihica PV-4, when using lactate as an electron donor, However, DMSO and thiosulfate cannot be used as electron acceptors.

[0033] The strain is currently difficult to carry out genetic manipulation, and the applicant has carried out genetic modification on it to make it easier to carry out genetic manipulation. The specific method is as follows:

[0034] The wild-type Loihiwanella (S.loihica) PV-4 ...

Embodiment 2

[0038] Example 2: Construction of ypjD gene knockout suicide plasmid

[0039] The upstream and downstream fragments of the ypjD gene were connected and introduced into the multiple cloning site of the recombination-integrated suicide plasmid pDS3.0 to obtain the suicide knockout plasmid p△ypjD containing the ypjD gene. The specific operation is as follows:

[0040] According to the whole genome sequence (GCA_000016065.1) of S. loihica PV-4 in the GenBank database, primers for knocking out ypjD were designed respectively. The primer sequences are as follows:

[0041] ypjD-sacI-3o:AGAGCTCctgggctcaggctcttg

[0042] ypjD-sacI-3i:agagacgacctaagccagtcttcttgtggtcatcgacctg

[0043] ypjD-sacI-5i:gactggcttaggtcgtctctacgctaaattccgcacactt

[0044] ypjD-sacI-5o:AGAGCTCatccatgatagagagcagca

[0045] PCR system: 25 μl of 2×MIX, 22 μl of deionized water, 1 μl of F primer, 1 μl of R primer, and 1 μl of DNA template.

[0046] PCR reaction conditions: 95°C for 5 minutes; 95°C for 30 seconds,...

Embodiment 3

[0051] Example 3: Construction of Gene Knockout Engineering Strain PV-4ΔypjD

[0052] First, the constructed gene knockout suicide plasmid p△ypjD was transferred into the auxotrophic strain E.coliWM3064. The suicide plasmid contained the R6K replicon, which could replicate in the bacteria containing the t protein, while in the strain without the t protein cannot replicate, so when the auxotrophic strain E.coli WM3064 containing the suicide knockout plasmid p△ypjD enters the host strain S.loihica PV-4 (genetic modification has been carried out with reference to the method described in Example 1) by conjugation, then Unable to replicate in this strain, it is therefore integrated into the homologous sequence in the genome. Since the integrated single-crossover strain contains a gentamicin-resistant gene and a sucrose-sensitive gene sacB, it can be expressed in 15 μg / ml Gentamicin was grown on an LB medium plate to obtain a single-crossover transformant in which the suicide plasmi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a shewanella loihica genetic engineering strain capable of producing high-yield hemoglobin and a construction method of the genetic engineering strain. According to the method,a Shewanella loihica mutant strain with a deep red phenotype is obtained by random insertion mutation of a transposon. Genetic identification and genetic complementation experiments confirm that a ypiD gene is inactivated by insertional mutation and accumulation of extracellular red matter is caused. The red substance is identified as hemoglobin by mass spectrometry, and then the ypiD gene is knocked out by homologous recombination, so that the shewanella loihica genetic engineering strain ypjD-knockout PV-4 capable of producing high-yield hemoglobin is obtained, the strain can secrete a large amount of hemoglobin extracellularly, and the biomass (OD600) reaches 2.4-2.6 under shake flask culture conditions, and the hemoglobin production is 90-120 mg / L, and great application value is provided.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a Leuchwanella engineering bacterium with knockout gene ypjD and a construction method thereof, and the engineering bacterium can be used to produce heme. Background technique [0002] Heme is protoporphyrin IX containing divalent iron ions, and protoporphyrin IX contains 4 pyrrole ring structures, which widely exist in nature, from microorganisms to human cells, and it is involved in many biological processes , including transport and storage of oxygen molecules (hemoglobin and myoglobin), electron transport in oxidative phosphorylation (b-type and c-type cytochromes), oxidation of hydrocarbons (cytochrome P450 and cellular pigment oxidase). In microorganisms, protoporphyrin IX is mainly the main component of the synthesis of cytochrome, vitamin B12 and bacteriochlorophyll, and then participates in important physiological activities such as bacterial res...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12P17/18C12R1/01
CPCC07K14/195C12N15/74C12P17/182
Inventor邱东茹戴景程周集中
OwnerINST OF AQUATIC LIFE ACAD SINICA