Preparation method of recombinant human deoxyribonuclease I
A technology of enzyme cutting sites and expression vectors, applied in the biological field, can solve problems such as easy occurrence of amino acid chains, low activity of recombinant proteins, and inactivation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] The construction of embodiment 1 rHuDNase I secretion expression plasmid
[0062] The rHuDNase I gene fragment used in the present invention is obtained through high-fidelity Pfu enzyme PCR amplification (the template is a human liver cDNA library, the genbank accession number of the sequence is AAA63170.1, and the primer sequences are ATCTCGAGAAAAGACATCATCATCATCATCATCTGAAGATCGCAGCC and ATGCGGCCGCTCACTTCAGCATCACCTC), and the fragment length is about 0.85kb ( figure 1 -a); Simultaneously PCR amplified the rHuDNase I gene fragment with 6×His tag ( figure 1 -b), construct corresponding expression plasmids in parallel.
[0063] After the PCR product was digested (restriction site is Xho I / Not I), it was inserted into the expression plasmid pPIC9 ( figure 2 ). After the two fragments are ligated by T4DNA ligase, transform DH5α competent cells; the obtained transformants are detected by PCR to see if a 0.85kb band can be amplified; for the colonies that can amplify the tar...
Embodiment 2
[0065] Construction and screening of embodiment 2 rHuDNase I Pichia pastoris expression strain
[0066] The plasmid pP / DNase (6×His) containing the expression unit of rHuDNase I constructed in Example 1 was linearized by Sal I enzyme, electrotransformed (1500V, 5ms) Pichia pastoris competent cells, and then spread on MD Plates (containing 20 g of glucose, 13.4 g of YNB, and 0.4 mg of biotin per liter) were cultured at 28°C until transformants grew out.
[0067] Select 4 transformants (recorded as 1-4 in sequence), extract their genomic DNA, and then perform PCR detection to observe whether a characteristic 0.85 kb band can be amplified. Each transformant was cultured in 5mL BMGY at 28°C for 48 hours, then continuously added with 1% methanol to induce, take the supernatant, and observe it by SDS-PAGE electrophoresis. Compared with the blank control, a band with a molecular weight close to human DNase I can be seen ( image 3 ). It shows that all of these transformants can su...
Embodiment 3
[0074] Example 3 Induced expression of rHuDNase I in yeast
[0075] The 4 transformants obtained in Example 2 were inoculated in 4 mL of YPD (containing 10 g of yeast extract, 20 g of peptone, and 20 g of glucose per liter), respectively, and cultured at 28° C. overnight.
[0076] 2mL seed solution was inserted into 500mL BMMY (each liter contains 10g of yeast extract, 20g of peptone, 13.4g of YNB, 10g of methanol, 0.4mg of biotin), and cultivated overnight at 28°C.
[0077] 500mL culture medium was centrifuged, the bacteria were suspended in 250mL BMMY, and 1% methanol was used to induce expression.
[0078] Express the situation as Figure 4 , combined with Figure 3-4 As can be seen from Table 1, the expression levels of each transformant are high, and there is no significant difference in the expression level among different transformants.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More