Primers and probe, kit and method used for precise and quantitative detection of ovine-derived materials
A primer-probe, quantitative detection technology, used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., can solve the deviation of quantitative results of PCR amplification efficiency, affect the dynamic PCR amplification process, improve Detection cost and other issues, to avoid cross-contamination and false positives, reliable results, accurate and sensitive results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] This embodiment tests the extraction quality of the total DNA of the sample by agarose gel electrophoresis.
[0028] The method used in this example is to prepare 2% agarose gel, take 2 μL of DNA sample and mix it with bromophenol blue, use DL2000 DNA Ladder Marker as a reference, and perform electrophoresis at a constant voltage of 100 V for 20 min. After the gel was stained with EB, it was imaged with a gel imaging system.
[0029] In this example, the total DNA of the samples mutton, chicken, duck, pigeon, goose, beef, horse, pork, donkey, rabbit, dog, rat, mouse, and fox was detected The quality of the extraction, and use sterile double distilled water as a blank control.
[0030] like figure 1 As shown, all samples can have bands above 2000 bp, indicating that all the samples to be tested have successfully extracted DNA.
Embodiment 2
[0032] The inventors of the present invention amplified the mutton replication protein A1 gene for the first time by real-time fluorescent PCR (probe method). The mutton replication protein A1 gene primer probe sequence used is Mutt-F5: CACCTCTTTCCA AGCATCCAGGTA (SEQ ID No. 1), GCTCACTCCTCCAGCCTAGCAAG (SEQ ID No. 2), FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1 (SEQ ID No. 3).
[0033] 1. Main testing instruments used:
[0034] Micropipette (eppendorf), fluorescent quantitative PCR instrument (AB7500), high-speed desktop centrifuge (12 000 r / min), electrophoresis instrument (DYY22C type), etc.
[0035] 2. Main reagents for detection:
[0036] 2×TaqMan Universal PCR Master Mix (ABI), primer probe (Thermofisher), etc.
[0037] 3. Main steps of detection:
[0038] Real-time fluorescent PCR reaction system:
[0039] 2×Mastermix 12.5μL
[0040] Upstream primer (10mM) 1.0μL
[0041] Downstream primer (10mM) 1.0μL
[0042] Probe (10mM) 0.5μL
[0043] Template DNA 50ng
[0044] Add ste...
Embodiment 3
[0053] In this embodiment, the copy number of the mutton gene is quantitatively detected by digital PCR using the primer probe sequence of the mutton replication protein A1 gene. The mutton replication protein A1 gene primer probe sequence used is Mutt-F5: CACCTCTTTCCA AGCATCCAGGTA (SEQ ID No. 1), GCTCACTCCTCCAGCCTAGCAAG (SEQ ID No. 2), FAM-CTGGGTGAGCGTGGCACATGGAGGC-BHQ1 (SEQ ID No. 3).
[0054] 1. Main testing instruments used:
[0055] Micropipette (eppendorf), droplet digital PCR instrument (Bio-rad, QX200), high-speed desktop centrifuge (12 000 r / min), etc.
[0056] 2. Main reagents for detection:
[0057] 2×TaqMan Master Mix (Bio-rad), primer probe (Thermofisher), etc.
[0058] 3. Main steps of detection:
[0059] Digital PCR reaction system:
[0060] 2×Mastermix 10 μL
[0061] Upstream primer (10mM) 1.0μL
[0062] Downstream primer (10mM) 1.0μL
[0063] Probe (10mM) 0.5μL
[0064] Template DNA 5.0 μL
[0065] Sterile double distilled water 2.5μL
[0066] Note: ...
PUM
Property | Measurement | Unit |
---|---|---|
Upstream primer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com