Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

miRNA related with resistance on phytophthora root rot of soybean and application thereof

A technology of Phytophthora and Phytophthora, which is applied in miRNA and its application fields, can solve problems such as difficulties in the prevention and control of Phytophthora root rot of soybean, achieve good application prospects and reduce resistance

Inactive Publication Date: 2017-05-10
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Soybean blight is a soil-borne disease that can infect and cause damage at any growth stage of soybeans, so the control of soybean Phytophthora root rot is very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA related with resistance on phytophthora root rot of soybean and application thereof
  • miRNA related with resistance on phytophthora root rot of soybean and application thereof
  • miRNA related with resistance on phytophthora root rot of soybean and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1. Stem-loop real-time fluorescent quantitative PCR (Stem-loop qPCR) analysis of the role of gma-miR1510b in the mechanism of soybean resistance to Phytophthora root rot

[0023] 1. Design of primers for gma-miR1510b reverse transcription and Stem-loop quantitative PCR

[0024] According to the sequence of gma-miR1510b mature miRNA and the sequence of soybean internal reference gene——GmSnoR I, the primers were designed as follows:

[0025] (1) gma-miR1510b Stem-loop RT primer:

[0026] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGTGGA (SEQ ID NO: 3),

[0027](2) gma-miR1510b forward primer: CTGTGCTGTGTTGTTTTACCTAT (SEQ ID NO: 4),

[0028] (3) gma-miR1510b reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO: 5),

[0029] (4) GmSnoR I forward primer: GAAGATGAAGAGCTTTGTATATTC (SEQ ID NO: 6),

[0030] (5) GmSnoR I reverse primer: ACTCAGAGAGTTGCTTTCTGTG (SEQ ID NO: 7).

[0031] 2. Material cultivation and soybean Phytophthora infection

[0032] (1) Cultivation of Phyt...

Embodiment 2

[0061] Example 2. Verification of the gma-miR1510b target gene: use the 5' RACE method to verify the cleavage site of gma-miR1510b to the target gene Glyma.16G135500

[0062] 1. The 5'RACE primers were designed as follows:

[0063] Glyma.16G135500 Outer reverse primer: CCGTGAAGGACATCTCTTCCATTCCAATA (SEQ ID NO:8),

[0064] Glyma.16G135500 Inner reverse primer: CTCCCAATTCATAATCTTTGAAGCAACAAGC (SEQ ID NO:9).

[0065] 2. RNA extraction is the same as in Example 1.

[0066] 3. Enrichment of mRNA:

[0067] (1) Use Promega's mRNA Isolation Systems Kit, for the isolation of mRNA.

[0068] Take 1mg total RNA and add RNase Free dH 2 O dilute to 500 μl; incubate at 65°C for 10 minutes, add 3 μl OligodT, 13 μl 20×SSC, mix gently and cool at room temperature for 10 minutes; take a tube of magnetic beads, flick the bottom of the tube to resuspend the magnetic beads, and place them on the magnetic column Remove the supernatant after 30s; wash the magnetic beads three times with 300μl ...

Embodiment 3

[0082] Example 3. Functional analysis of gma-miR1510b and target gene Glyma.16G135500 in soybean response to Phytophthora soybean

[0083] 1. Planting of soybeans, cultivation of Phytophthora, inoculation method, RNA extraction, reverse transcription and real-time fluorescence quantification refer to Example 1, and the sampling time points are 0, 6 and 12 hours.

[0084] 2. Glyma.16G135500 quantitative primers are designed as follows:

[0085] Glyma.16G135500 forward primer: CTGGTTCCGTAACAAACTCCC (SEQ ID NO: 10)

[0086] Glyma.16G135500 reverse primer: GAAAAACCCCACCAAACAAAGG (SEQ ID NO: 11)

[0087] 3. See image 3 , the results of real-time fluorescent quantitative PCR analysis found that the expression level of gma-miR1510b showed a significant down-regulation trend at 6h and 12h after inoculation with Phytophthora soybean, while the expression level of Glyma.16G135500 was significantly up-regulated at 6h and 12h. After Phytophthora, the expressions of gma-miR1510b and Gl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a miRNA related with resistance on phytophthora root rot of soybean and an application thereof. The miRNA is related with the performance of soybean on resisting phytophthora root rot, and has a sequence represented by the SEQ ID No.1 in the sequence table. The invention discloses an application of the miRNA in the breeding of novel soybean species capable of resisting phytophthora root rot. The miRNA can inhibit gma-miR1510b, thus the expression of target gene Glyma.16G135500 is increased, and the resistance of soybean on phytophthora root rot is enhanced. The overexpression vector of soybean gma-miR1510b is constructed, the plant expression vector is transferred into agrobacterium K599 competent cells, and a soybean cotyledonary node mediated transgene method is used to convert hairy roots of soybean. The anti-disease analysis on the obtained transgenic soybean hairy roots shows that the resistance of the transgenic hairy roots on phytophthora root rot of soybean is obviously reduced.

Description

technical field [0001] The invention relates to a miRNA related to soybean phytophthora resistance and application thereof, belonging to the field of biotechnology. Background technique [0002] Phytophthora Root Rot of Soybean (PRR) is one of the devastating diseases that harm soybean production caused by Phytophthora sojae (P.sojae). The disease was first discovered in Indiana, U.S. in 1948, and has been expanding and spreading in the main soybean producing areas of the world so far. my country's Shen Chongyao was the first to isolate Phytophthora soybean in Northeast my country in 1989. At present, Phytophthora sojae has also been isolated in other soybean production areas, showing rich virulence diversity. The disease has occurred in some soybean production areas in my country and caused great losses in some areas. Soybean blight is a soil-borne disease that can infect and cause damage at any growth stage of soybeans, so the prevention and control of soybean Phytophtho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/29C12N15/82A01H5/00
CPCC12N15/113C07K14/415C12N15/8205C12N15/8282C12N2310/141
Inventor 邢邯崔晓霞郭娜马玲
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com